View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_39 (Length: 297)
Name: NF12820_low_39
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 7267104 - 7267393
Alignment:
| Q |
1 |
taacagacactgcacttttacacacttcattttgaagctaatctttatcacattatctaatttaccatgtcttttatcatattaccatatggtctaatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7267104 |
taacagacactgcacttttacacacttcattttgaagctaatctttatcacattatctaatttaccatgtcttttatcatattaccatatggtctaatga |
7267203 |
T |
|
| Q |
101 |
tattaattttcatcgactgtcagtgtaaaacttttttagtttttacactatcnnnnnnnnnngaatcagcatgtatgaacttttagttagatttgattaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7267204 |
tattaattttcatcgactgtcagtgtaaaacttttttagtttttacgctatc-tttttttttgaatcagcatgcatgaacttttagttagatttgattaa |
7267302 |
T |
|
| Q |
201 |
agtcaaatgatttccatgatctaagggttactattaatactattatattgtttcagtattaatgaagcagtagaaccatattttcttctct |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7267303 |
agtcaaatgatttccatgatctaagggttactattaatactattatattgtttcattattaatgaagcagtagaagcatattttcttctct |
7267393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University