View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_40 (Length: 291)
Name: NF12820_low_40
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_40 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 212 - 271
Target Start/End: Complemental strand, 34102653 - 34102594
Alignment:
| Q |
212 |
tgttttcttgatttaatgnnnnnnnncattcaatcttcaattttgtatgatcatatatgt |
271 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34102653 |
tgttttcttgatttaatgttttttttcattcaatcttcaattttgtatgatcatatatgt |
34102594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University