View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_45 (Length: 259)
Name: NF12820_low_45
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_45 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 240
Target Start/End: Original strand, 13726451 - 13726687
Alignment:
| Q |
4 |
ccttgtaatggatacggtaacactaagatgtgtggtgcatgttttttgcttttattctccattgatttttgtggtgtctcttttcttctggaatgtgttt |
103 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13726451 |
ccttgtaatggatatggaaacactaagatgtgtggtgcatgttttttgcttttattctccattgatttttgtggtgtctcttttcttctggaatgtgttt |
13726550 |
T |
 |
| Q |
104 |
atatatgaagaagggtgtaaaagtaatagacataatgatattctaatcaatgaatccattgaacaaaaaagattgcaaagcatcaattgattgtgacctt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
13726551 |
atatatgaagaagggtgtaaaagtaatagacataatgatattctaatcaatgaatgcattgaacaaaaaagatagcaaagcatcaagtgattgtgacctt |
13726650 |
T |
 |
| Q |
204 |
tccatgtaggatttagaccttttcctaatgtggtgtg |
240 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13726651 |
tccatgtaggattttgaccttttcctaatgtggtgtg |
13726687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University