View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_49 (Length: 252)
Name: NF12820_low_49
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 6e-58; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 20 - 145
Target Start/End: Complemental strand, 43187985 - 43187860
Alignment:
| Q |
20 |
gtcacaatatgaattcaattaattgcagtgttttaaagactgaacattgaaccaagaatatctctggatcatggttgaattgttttaaaccactcaaacc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43187985 |
gtcacaatatgaattcaattaattgcagtgttttaaagactgaacattgaaccaagaatatctctggatcatggttgaattgttttaaatcactcaaacc |
43187886 |
T |
 |
| Q |
120 |
gcaattaaactactcaaatagcagaa |
145 |
Q |
| |
|
|||||||||||| ||||||| ||||| |
|
|
| T |
43187885 |
gcaattaaactaatcaaataacagaa |
43187860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 145 - 236
Target Start/End: Complemental strand, 43187248 - 43187158
Alignment:
| Q |
145 |
aaacacagatttacacagtcatgagaattcaaactcaatcaaaaacacacttgattcccttctctattccgttgattggaagattttcagtg |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
43187248 |
aaacacagatt-acacagtcatgagaattcaaactcaatcaaaaacacacttgattcccttctctattccattgatcggaagattttcagtg |
43187158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 21 - 64
Target Start/End: Complemental strand, 22710133 - 22710090
Alignment:
| Q |
21 |
tcacaatatgaattcaattaattgcagtgttttaaagactgaac |
64 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22710133 |
tcacaatatgacttcaattaattgcagtgttttaaagactgaac |
22710090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University