View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_61 (Length: 233)
Name: NF12820_low_61
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_61 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 20 - 217
Target Start/End: Original strand, 31455257 - 31455454
Alignment:
| Q |
20 |
catatatgagtatgattgctttagaaagaaggcaaagaaggaaatttctaagcaacttagtgaaatgaagaaaatggaaaacaaagtaaagcttttttct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455257 |
catatatgagtatgattgctttagaaagaaggcaaagaaggaaatttcaaagcaacttggtgaaatgaagaaaatggaaaacaaagtaaagcttttttct |
31455356 |
T |
 |
| Q |
120 |
attatgggacaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctatatttcgttctcttttactattcat |
217 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455357 |
attatgggccaagatcaaaatttaatatttttggctaaggttttaagagaagctaccaccatcacaatatctatatttcgttctcttttactattcat |
31455454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University