View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_62 (Length: 232)
Name: NF12820_low_62
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 213
Target Start/End: Complemental strand, 53855401 - 53855195
Alignment:
| Q |
8 |
ggagaagc-aaaggcattgcagcaggaggagtagcttgagtcctaactctatgaatgtgagaatttttctttggatcgaatctccgttcctcaattttgt |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53855401 |
ggagaagcgaaaggcattgcagcaggaggagtagcttgagtcctaactctatgaatgtgagaatttttctttggatcgaatctccgttcctcaattttgt |
53855302 |
T |
|
| Q |
107 |
caccgccgttgcctgctccactggttcttcgaattggagtaacagagtcggaacaacagcaatgaaatttgagattaccgagtggaactcgttgagcatc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53855301 |
caccgccgttgcctgctccactggttcttcgaattggagtaacagagtcggaacaacagcaatgaaatttgagattaccgagtggaactcgttgagcatc |
53855202 |
T |
|
| Q |
207 |
gaagcac |
213 |
Q |
| |
|
||||||| |
|
|
| T |
53855201 |
gaagcac |
53855195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University