View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12820_low_65 (Length: 220)
Name: NF12820_low_65
Description: NF12820
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12820_low_65 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 14380521 - 14380715
Alignment:
| Q |
17 |
atgtagaagaggcatataacctaaaatatgtagtttttgaaatttgttttccagggctaacaattgtggaatgtcacattataactgaaatcggccgatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14380521 |
atgtagaagaggcatataacctaaaatatgtagtttttgaaatttgttttccagggctaacaattgtggaatgtcacattataactgaaatcggccgatt |
14380620 |
T |
 |
| Q |
117 |
attggtatagtgtgaaacgcagtgaaatgaaaagacacaacgttcatttttagagatctaaccaaccaattaactaacaacatttcatctcactc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14380621 |
attggtatagtgtgaaacgcagtgaaatgaaaagacacaacgttcatttttagagatctaaccaaccaattaactaacaacatttcatttcactc |
14380715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University