View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12821_high_12 (Length: 262)
Name: NF12821_high_12
Description: NF12821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12821_high_12 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 68 - 262
Target Start/End: Original strand, 16034108 - 16034303
Alignment:
| Q |
68 |
cttgaaccatttagaaggagcgtaacatacaaatttttcaaaataagcggttatccattgcatattgataaggtgaaacttcattcttgatggtggctga |
167 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
16034108 |
cttgaaccatttagaaggagtgtagcatacaaatttttcaaaataagcggttatccattgtatattgatagggtgaaacttcattcttgatggtggctga |
16034207 |
T |
 |
| Q |
168 |
agacacatcaacctaatttcttttttgattgtcatatttggtggacgaatccatccacctacttgtttatgat-cttcactttgtaatgctgctat |
262 |
Q |
| |
|
||||| ||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
16034208 |
agacatatcgacctaatttctttttttattgtcatatttggtggacgaatccatccacctacttgtttaggatccttcactttgtaatactgctat |
16034303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 16 - 72
Target Start/End: Original strand, 16033809 - 16033865
Alignment:
| Q |
16 |
acatcacctggaataaagtaacgtctctcactctcttttcacgcggtggttgcttga |
72 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
16033809 |
acatcacctggaataaagtaatgtctctcactctcttttcacgcggtggttgcttga |
16033865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University