View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12821_low_18 (Length: 235)
Name: NF12821_low_18
Description: NF12821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12821_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 223
Target Start/End: Complemental strand, 9967368 - 9967152
Alignment:
| Q |
8 |
agatggacatcaagtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgccctta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9967368 |
agatggacatcaagtagtaaacgaacatattgaaatctttctttaccctcgtgcgccttcagctgcatatacctttggaaagccgtcaaacatgccctta |
9967269 |
T |
 |
| Q |
108 |
gcataactaggttgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaa-gaaaatat |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9967268 |
gcataactaggttgtgcttgaaccctgactttaacagcttcaaatggacatagagctaaattggcaaatacttcagcagatgcactactaaggaaaatat |
9967169 |
T |
 |
| Q |
207 |
acaagacttctgtgctg |
223 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
9967168 |
acaagacttctgtgctg |
9967152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University