View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12821_low_22 (Length: 202)
Name: NF12821_low_22
Description: NF12821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12821_low_22 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 39 - 120
Target Start/End: Complemental strand, 48954553 - 48954472
Alignment:
| Q |
39 |
atatatagaggaccgagctatgtaaaggaaggttttttcccttcaaaacgatactgacgtacgtggctttgtaataaaccag |
120 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48954553 |
atatatagaggacggagctatgtaaaggaaggttttttcccttcaaaacgatactgacgtacgtggctttgtaacaaaccag |
48954472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 1116678 - 1116764
Alignment:
| Q |
1 |
tgtatgatttatacttttattttcaggtagggggaataatata--tagaggaccgagctatgtaaaggaaggttttttcccttcaaaa |
86 |
Q |
| |
|
||||||||| ||||||||||||||||||| | | ||||||||| ||||||| || |||||||||||| | ||||||||||||||| |
|
|
| T |
1116678 |
tgtatgattaatacttttattttcaggta-gagtaataatatatgtagaggattgatctatgtaaaggatagctttttcccttcaaaa |
1116764 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University