View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12821_low_7 (Length: 439)
Name: NF12821_low_7
Description: NF12821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12821_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 156 - 405
Target Start/End: Complemental strand, 43984108 - 43983859
Alignment:
| Q |
156 |
gatatctgcataagatgccgtgtctgattttgctacatcttttttggtttagcacgatattggtaagaaattttcaccgcttagcagtaattaatttcgt |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43984108 |
gatatctgcataagatgccgtgtctgattttgctacatcttttttggtttagcacgatattggtacgaaattttcaccgcttagcagtaattaatttcgt |
43984009 |
T |
|
| Q |
256 |
tgggaaatatgtgagagtcaataattaaactctgaaccttaggtttaaggagctcaaatctcttattacttggattaattatacttttgtatttggcatt |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43984008 |
tgggaaatatgtgagagtcaataattaaactctgaaccttatgtttaaggagcttaaatctcttattacttggatcaattatacttttgtatttggcatt |
43983909 |
T |
|
| Q |
356 |
gtttatgtttaataaaagtcattttattttggatcaattgaaggattgta |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43983908 |
gtttatgtttaataaaagtcattttattttggatcaattgaaggattgta |
43983859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 41 - 88
Target Start/End: Complemental strand, 43984223 - 43984176
Alignment:
| Q |
41 |
tggagaaatgtaggatatttgaaagctgttggttgagagttgttgtgc |
88 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
43984223 |
tggagaaatgtaggatatttgagagctgttggttgagagttgttgtgc |
43984176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University