View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12822_low_14 (Length: 214)
Name: NF12822_low_14
Description: NF12822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12822_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 19 - 196
Target Start/End: Original strand, 28940112 - 28940289
Alignment:
| Q |
19 |
gggtatggggtaaactaactgagagagatgtaagtatcttgaaaagatggtttctcatgcaagtttcagagaatatgatggtgtgtgttttgttggcact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940112 |
gggtatggggtaaactaactgagagagatgtaagtatcttgaaaagatggtttctcatgcaagtttcagagaatatgatggtgtgtgttttgttggcact |
28940211 |
T |
|
| Q |
119 |
atgtagcttaaatatgagtctaatgtgttttggaattcagtgagtgtgtcatatatgagaaacaaatttagctggaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28940212 |
atgtagcttaaatatgagtctaatgtgttttggaattcagtgagtgtgtcatatatgagaaacaaatttagctggaaa |
28940289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University