View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12822_low_16 (Length: 204)
Name: NF12822_low_16
Description: NF12822
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12822_low_16 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 7e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 7e-85
Query Start/End: Original strand, 21 - 204
Target Start/End: Original strand, 46353086 - 46353269
Alignment:
| Q |
21 |
gagtcatttcttaacataaccaaatcattaagatactattgttgatatttcaatagccatttggcttaattccaatgcatactaattaacttttcacggt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46353086 |
gagtcatttcttaacataaccaaatcattaagatactattgttgatatttcaatagccatttggcttaattctaatgcatactaattaacttttcacggt |
46353185 |
T |
 |
| Q |
121 |
aaagtaaaaaacaaaacnnnnnnnggaagcaatataatgatgaaatctgaaaacttcaaaatcagtcaaattactattctcttt |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46353186 |
aaagtaaaaaacaaaactttttttggaagcaatataatgatgaaatctgaaaacttcaaaatcagtcaaattactattctcttt |
46353269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University