View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12823_high_5 (Length: 250)
Name: NF12823_high_5
Description: NF12823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12823_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 16 - 244
Target Start/End: Original strand, 33718693 - 33718921
Alignment:
| Q |
16 |
tccttctcctcctccactctcccctccgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcatctccggctccacctcaaccgcaaactcat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33718693 |
tccttctcctcctccactctcccctccgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcgtctccggctccacctcaaccgcaaactcat |
33718792 |
T |
 |
| Q |
116 |
taccggaatttcatctcccggattccaccatcggaagcagcagcagcatggagcgaattccaccaacgaacatggaaacctgccgcgaatgcaacatagc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33718793 |
taccggaatttcatctcccggattccaccatcggaagcagcagcagcatggagcgaattccaccaacgaacatggaaacctgccgcgaatgcaacatagc |
33718892 |
T |
 |
| Q |
216 |
aggatgtttaggatgcaatttcttctctc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33718893 |
aggatgtttaggatgcaatttcttctctc |
33718921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 33720864 - 33720921
Alignment:
| Q |
183 |
gaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc |
240 |
Q |
| |
|
|||||| |||||||| || ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33720864 |
gaacatagaaacctgtcgggaatgcaacatagcaggatgtttaggatgcaatttcttc |
33720921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 196 - 240
Target Start/End: Original strand, 33735540 - 33735584
Alignment:
| Q |
196 |
tgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc |
240 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33735540 |
tgccgggaatgcaacatagcaggatgtttaggatgcaatttcttc |
33735584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 173 - 240
Target Start/End: Original strand, 33750323 - 33750390
Alignment:
| Q |
173 |
ttccaccaacgaacatggaaacctgccgcgaatgcaacatagcaggatgtttaggatgcaatttcttc |
240 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||||||| |||||||| ||||||||| |||||||| |
|
|
| T |
33750323 |
ttccacctgcgaacatagaaacctgccaggaatgcaacattgcaggatgcttaggatgcgatttcttc |
33750390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 16 - 106
Target Start/End: Original strand, 33750172 - 33750262
Alignment:
| Q |
16 |
tccttctcctcctccactctcccctccgatcaagaacaatccgtcattgtcaccgccctaaccaaagtcatctccggctccacctcaaccg |
106 |
Q |
| |
|
||||||||| || | || ||| ||||||||||||||| || ||||| ||| | ||| ||||||| ||| |||||||||||||||| |||| |
|
|
| T |
33750172 |
tccttctccgccactacactcacctccgatcaagaactctctgtcatcgtctctgccttaaccaatgtcgtctccggctccacctccaccg |
33750262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University