View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12823_high_6 (Length: 220)
Name: NF12823_high_6
Description: NF12823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12823_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 39394868 - 39394656
Alignment:
| Q |
1 |
tgcttttttgctattctcttccgcttttgttgctgatttcaattcgctcttaagcatattcaattgttcaattaaattttccgccttcatagattgtccc |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394868 |
tgctttcttgctattctcttccgcttttgttgctgatttcaattcgctcttaagcatattcaattgttcaattaaattttccgccttcatagattgtccc |
39394769 |
T |
|
| Q |
101 |
tctccaacacccttttgagtttcctttaccttgatctttggcaactctttctcagttactttcttatcctctaaatctttgattttgttttcgcctaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39394768 |
tctccaacacccttttgagtttcctttaccttgatctttggcaactctttctcagttactttcttatcctctaaatctttgattttgttttcgcctaatt |
39394669 |
T |
|
| Q |
201 |
gaagtgtctttaa |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
39394668 |
gaagtgtctttaa |
39394656 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University