View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12826_low_14 (Length: 243)
Name: NF12826_low_14
Description: NF12826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12826_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 223
Target Start/End: Original strand, 22239054 - 22239262
Alignment:
| Q |
15 |
gcacagaggtgagggatgataacaacaaaaagatattatgatatgctgcttcttttttaatgtttgatgttt-acaaactatataatatacactaaatga |
113 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22239054 |
gcacaaaggtgagggatgataacaacaaaaagatattatgatatgctgcttcttttt-aatgtttgatgttttacaaactatataatatacactaaatga |
22239152 |
T |
 |
| Q |
114 |
aggttcacaagcaaggaagcttagttggaagagccattgatctctctaggttgagcggctacaatgatcttctgagtgaactggagaaactatttggcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22239153 |
aggttcacaagcaaggaagcttagttggaagagccattgatctctctaggttgagcggctacaatgatcttctgagtgaactggagaaactatttggcat |
22239252 |
T |
 |
| Q |
214 |
ggaaggactt |
223 |
Q |
| |
|
|||||||||| |
|
|
| T |
22239253 |
ggaaggactt |
22239262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 5e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 97 - 219
Target Start/End: Complemental strand, 39980906 - 39980784
Alignment:
| Q |
97 |
taatatacactaaatgaaggttcacaagcaaggaagcttagttggaagagccattgatctctctaggttgagcggctacaatgatcttctgagtgaactg |
196 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||| || || |||||| ||||||||||||| |||||||||| |
|
|
| T |
39980906 |
taatatacaatgaatgaaggttcacaagcaaggtagcttagttggaagagccattgatctgtcaagattgagcagctacaatgatctggtgagtgaacta |
39980807 |
T |
 |
| Q |
197 |
gagaaactatttggcatggaagg |
219 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
39980806 |
gagagactatttggcatggaagg |
39980784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University