View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12826_low_20 (Length: 227)
Name: NF12826_low_20
Description: NF12826
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12826_low_20 |
 | |
|
| [»] chr5 (4 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 34 - 227
Target Start/End: Complemental strand, 28104654 - 28104474
Alignment:
| Q |
34 |
ggagtccgtgtcttttctatgaatggtattggtattggtattgggatcgtgtcttttctacacaaattttggcgttgacttgaatttatttatttttgaa |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
28104654 |
ggagtccgtgtcttttctatgaatggtattggtattgg------gatcgtgtcttttctacata-------gcgttgacttgaatttatttatttttgaa |
28104568 |
T |
|
| Q |
134 |
aggcaaataaaatttcaattaatccaatccaagtacaagacaatccggaattgtgttcaaaattacaaactacatgagccgataaacagccaat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28104567 |
aggcaaataaaatttcaattaatccaatccaagtacaagacaatccggaattgtgttcaaaattacaaactacatgagccgataaacagccaat |
28104474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 90 - 227
Target Start/End: Complemental strand, 26641540 - 26641397
Alignment:
| Q |
90 |
tctacacaaattttggcgttgacttgaatttatttatttttgaaaggcaaataaaatttcaattaatccaatccaagtacaagacaatccggaattgtgt |
189 |
Q |
| |
|
|||||||||||||| | | ||||||||||||||||||||||||| ||||||||||||||||||||||||||| || ||||||| | | |||||||||| |
|
|
| T |
26641540 |
tctacacaaattttagtgctgacttgaatttatttatttttgaacatcaaataaaatttcaattaatccaatcctagcacaagacgaacgggaattgtgt |
26641441 |
T |
|
| Q |
190 |
tcaaaatta------caaactacatgagccgataaacagccaat |
227 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
26641440 |
ccaaaattacaaatacaaactacatgagccgataaacagccaat |
26641397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 65
Target Start/End: Complemental strand, 26642350 - 26642286
Alignment:
| Q |
1 |
tgccttggaagtggaatctcgcccagctaaaagggagtccgtgtcttttctatgaatggtattgg |
65 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
26642350 |
tgccttggaagtggaatctcgcccgcctaaaagggagtccatgtcttttctatgaatggtgttgg |
26642286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 28105114 - 28105061
Alignment:
| Q |
1 |
tgccttggaagtggaatctcgcccagctaaaagggagtccgtgtcttttctatg |
54 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||| ||||||||||||| |
|
|
| T |
28105114 |
tgccttggaagtggaatctcgcccggctaaaagggaatccatgtcttttctatg |
28105061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University