View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12828_high_6 (Length: 216)
Name: NF12828_high_6
Description: NF12828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12828_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 211
Target Start/End: Complemental strand, 30248940 - 30248745
Alignment:
| Q |
16 |
agttggtggtggtttcaattcaacaacactaaagaagaataagaaaagcacgaataacaacagcaatagcacacttgctttctttctatggagcaacgtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30248940 |
agttggtggtggtttcaattcaacaacactaaagaagaataagaaaagcacgaataacaacagcaatagcacacttgctttctttctatggagcaacgtg |
30248841 |
T |
 |
| Q |
116 |
ctgtgctgttcatgttattttcaacattatgattcactcgtttttggagctttggtgaaactgaagcttccaacatattcttttccctttgcttct |
211 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30248840 |
ttgtgctgatcatgttattttcaacattataattcactcgtttttggagcattggtgaaactgaagcttccaacatattcttttcccttttcttct |
30248745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 89; Significance: 4e-43; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 107 - 211
Target Start/End: Complemental strand, 21506430 - 21506326
Alignment:
| Q |
107 |
agcaacgtgctgtgctgttcatgttattttcaacattatgattcactcgtttttggagctttggtgaaactgaagcttccaacatattcttttccctttg |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21506430 |
agcaacgtgctgtgttgttcatgttattttcaacattatgattcactcgtttttggagcattggtgaaactgaagcttccatcatattcttttccctttt |
21506331 |
T |
 |
| Q |
207 |
cttct |
211 |
Q |
| |
|
||||| |
|
|
| T |
21506330 |
cttct |
21506326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 20 - 75
Target Start/End: Complemental strand, 21507850 - 21507795
Alignment:
| Q |
20 |
ggtggtggtttcaattcaacaacactaaagaagaataagaaaagcacgaataacaa |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21507850 |
ggtggtggtttcaattcaacaacactaaagaagaataagaaaagcacgaataacaa |
21507795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 71 - 115
Target Start/End: Complemental strand, 21506541 - 21506497
Alignment:
| Q |
71 |
aacaacagcaatagcacacttgctttctttctatggagcaacgtg |
115 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
21506541 |
aacaacaacaaaagcacacttgctttctttctatgcagcaacgtg |
21506497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University