View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12828_low_4 (Length: 300)
Name: NF12828_low_4
Description: NF12828
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12828_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 35 - 281
Target Start/End: Original strand, 49244403 - 49244644
Alignment:
| Q |
35 |
gttacacaaaattggttttcannnnnnnaaccccaaacctcactaacaattttctctctctttctttcatatataaaccaactaaaagtgagactcgtat |
134 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
49244403 |
gttacacaaaattggttttcatttttttaaccccaaacctcactaacaattttctctctctttctttcatatataaaccaactaagagtgagactcgt-- |
49244500 |
T |
 |
| Q |
135 |
cgtatggaagagtacagtaacaaatcactttctgaaatgagtaacagaaaacgtgccactactattaaaaccgaagaggttctaaatgttgaacgtgaaa |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244501 |
---atggaagagtacagtaacaaatcactttctgaaatgagtaacagaaaacgtgccactactattaaaaccgaagaggttctaaatgttgaacgtgaaa |
49244597 |
T |
 |
| Q |
235 |
gaaggaacaaattgaagcaaatgttcactcacctcactaccactgtc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49244598 |
gaaggaacaaattgaagcaaatgttcactcacctcactaccactgtc |
49244644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University