View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12829_high_7 (Length: 307)
Name: NF12829_high_7
Description: NF12829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12829_high_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 7199765 - 7199468
Alignment:
| Q |
1 |
ttaacgaacatatgtttcatctcagctaagatcgaagtaggttaccaacgctcattctaacattttcttaactcatttttatagcggttaaatattatag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||| || |||| |||||| |
|
|
| T |
7199765 |
ttaacgaacatatgtttcatctcagctaagatcgaagtaggttaccaacactcattctaatatttttttaactcatttttatagtggctaaaaattatat |
7199666 |
T |
 |
| Q |
101 |
gagctcgtcactttaggtggaactcacatgaatttattcaataaaaaatgaatattgaaaagaaaatattaaagcaaacattgataagactgttcatcaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7199665 |
gagctcgtcactttaggtggaactcacgtgaatttattcaataaaaaatgaatattgaaaagaaaatattaaagcaaacattgataagactgttcatcaa |
7199566 |
T |
 |
| Q |
201 |
aaatcaatcatttaatttatgattcaacattttcaaagttaggatatgatatgtttgcctctcacgactagtgattcattttcttctatgtattgttc |
298 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7199565 |
aaatcaatcattttatttatgattcatcattttcaaagttaggatatgatatgtttgccacacactactagtgattcattttcttctatgtattgttc |
7199468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University