View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12829_low_11 (Length: 264)
Name: NF12829_low_11
Description: NF12829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12829_low_11 |
 | |
|
| [»] scaffold0318 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 7000536 - 7000295
Alignment:
| Q |
18 |
ctgagccccagttgcagttaactgactttcctcacagttgcttgaatttaaagaaatttgatgaaggttgatttgttgaagtttggaaggaaaatggtat |
117 |
Q |
| |
|
|||||||||| | |||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| | |
|
|
| T |
7000536 |
ctgagccccaatggcagttaactgacttttctcatagttgcttgaatttaaagaaatttgatgaaggttgatttgttgaagtttggaaggagaatggttt |
7000437 |
T |
|
| Q |
118 |
------------ttttcatcaaaggggagttgttatttctggtctggaatgttggagtttagtaaccgcagttaactaccata-accagtaaaaggtagt |
204 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |||||| |
|
|
| T |
7000436 |
gtgtttatgtgtttttcatcaaaggggaattgttatttctggtctggaatgttggagtttagtaaccgaagttaactaccatagaccagtaaacggtagt |
7000337 |
T |
|
| Q |
205 |
taattgtccatggaaatatttttgtgagtttaaggtacctac |
246 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7000336 |
taattgtccatggagatatttttgtgagtttaaggtacctac |
7000295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0318 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0318
Description:
Target: scaffold0318; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 53 - 104
Target Start/End: Original strand, 4594 - 4645
Alignment:
| Q |
53 |
agttgcttgaatttaaagaaatttgatgaaggttgatttgttgaagtttgga |
104 |
Q |
| |
|
|||||||| | ||| ||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
4594 |
agttgcttaactttgaagaaatttgatggaggttgatttgttggagtttgga |
4645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 53 - 106
Target Start/End: Complemental strand, 12137535 - 12137482
Alignment:
| Q |
53 |
agttgcttgaatttaaagaaatttgatgaaggttgatttgttgaagtttggaag |
106 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||| || |||||| |||||||||||| |
|
|
| T |
12137535 |
agttgcttgactttgaagaaatttgatcaagattaatttgtcgaagtttggaag |
12137482 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University