View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12829_low_14 (Length: 215)
Name: NF12829_low_14
Description: NF12829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12829_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 42974514 - 42974313
Alignment:
| Q |
1 |
cacacgcaaactgcacaaccctaaccctacacgtgaacgacggatacaaaaccacaccatttattttcatcaccaacgctataactccatcacccatcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974514 |
cacacgcaaactgcacaaccctaaccctacacgtgaacgacggatacaaaaccacaccatttattttcatcaccaacgctataactccatcacccatcat |
42974415 |
T |
|
| Q |
101 |
ctccctgtaagcaccgtttgtccacgtcactctcccgtaaccgtccgatataaatcctggacacgtgtccaccatcagctttgcacttctctcttcatct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42974414 |
ctccctgtaagcaccgtttgtccacgtcactctcccgtaaccgtccgatataaaccctggacacgtgtccaccatcagctttgcacttctctcttcatct |
42974315 |
T |
|
| Q |
201 |
gt |
202 |
Q |
| |
|
|| |
|
|
| T |
42974314 |
gt |
42974313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 34059256 - 34059207
Alignment:
| Q |
121 |
tccacgtcactctcccgtaaccgtccgatataaatcctggacacgtgtcc |
170 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||||| |||| |
|
|
| T |
34059256 |
tccacgtcactctcccataaccgtccgatataaatccaggacacgcgtcc |
34059207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University