View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12829_low_4 (Length: 448)
Name: NF12829_low_4
Description: NF12829
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12829_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 2e-96; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 2e-96
Query Start/End: Original strand, 239 - 436
Target Start/End: Complemental strand, 54040294 - 54040094
Alignment:
| Q |
239 |
tagtcctgatttattagaaatagaaatcttgatttatttatgtctttttgggttttaaagaatgtgaaaatttatgttgcagacggtataataataaaat |
338 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54040294 |
tagtcctgatttattagaaatagaaatcttgatttatttatgtctttttgggttttaaagaatgtgaaaatttatgttgcagacggtataataataaaat |
54040195 |
T |
|
| Q |
339 |
tgtgctttag---tattgaatagaaaagataattttataactcttttttcttttgattttgtcgttgtttctgaaaagtggacttttaaattggatatct |
435 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54040194 |
tgtgctttagtactattgaatagaaaagataattttataacttttttttcttctgattttgtcgttgtttctgaaaagtggacttttaaattggatatct |
54040095 |
T |
|
| Q |
436 |
g |
436 |
Q |
| |
|
| |
|
|
| T |
54040094 |
g |
54040094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 162; E-Value: 3e-86
Query Start/End: Original strand, 53 - 226
Target Start/End: Complemental strand, 54040457 - 54040284
Alignment:
| Q |
53 |
atgttgttttatttgctgggttattataaaaattcgaacttgcatgtgatttatgtttggggttttatgttcttgatgttgattgcttttctgagttgaa |
152 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54040457 |
atgttgttttatttgctgggttattatcaaaattcgaacttgcatgtgatttatgtttggggttttatgttcttgatgttgattgcttttctgagttgaa |
54040358 |
T |
|
| Q |
153 |
attttgtgtatgattgatcgtgttcatcataaaaaattagggttgaaaaaagttgaatttaaccagtcctgatt |
226 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
54040357 |
attttgtgtatcattgatcgtgttcatcataaaaaattagggttgaaaaaagttgaatttaactagtcctgatt |
54040284 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 403 - 433
Target Start/End: Complemental strand, 54039982 - 54039952
Alignment:
| Q |
403 |
tttctgaaaagtggacttttaaattggatat |
433 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54039982 |
tttctgaaaagtggacttttaaattggatat |
54039952 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University