View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1282_low_9 (Length: 208)

Name: NF1282_low_9
Description: NF1282
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1282_low_9
NF1282_low_9
[»] chr3 (1 HSPs)
chr3 (1-117)||(48580012-48580128)
[»] chr1 (1 HSPs)
chr1 (63-101)||(47030104-47030142)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 117
Target Start/End: Original strand, 48580012 - 48580128
Alignment:
1 tattcgaataatccaccgccatggaatatgactaaacagagttgttgggtttgtgagagatggtgatggtgatggtgatgtctttgggtgtgtagtgaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48580012 tattcgaataatccaccgccatggaatatgactaaacagagctgttgggtttgtgagagatggtgatggtgatggtgatgtctttgggtgtgtagtgaat 48580111  T
101 atgggttgtctagattg 117  Q
    |||||||||||||||||    
48580112 atgggttgtctagattg 48580128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 101
Target Start/End: Original strand, 47030104 - 47030142
Alignment:
63 gtgatggtgatggtgatgtctttgggtgtgtagtgaata 101  Q
    |||||||||||||||||||||||||||||||||||||||    
47030104 gtgatggtgatggtgatgtctttgggtgtgtagtgaata 47030142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University