View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1283-Insertion-1 (Length: 148)
Name: NF1283-Insertion-1
Description: NF1283
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1283-Insertion-1 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 8 - 148
Target Start/End: Original strand, 14200993 - 14201133
Alignment:
| Q |
8 |
gatgatgcagaggatgaggaagagacagatgctgattttgacagagacggtaacggaggtttagaagccttgtttgaagatcttggtggtgaaatgaagg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
14200993 |
gatgatgcagaggatgaggaagagacagatgctgattttgacagagacggtaatggaggtttagaagccttgtttgaagatcttggtggagaaatgaagg |
14201092 |
T |
 |
| Q |
108 |
ctttgatctttaactgtgattgtggtgatgcagtacgatca |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14201093 |
ctttgatctttaactgtgattgtggtgatgcagtacgatca |
14201133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University