View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12830_high_1 (Length: 524)
Name: NF12830_high_1
Description: NF12830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12830_high_1 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 13 - 410
Target Start/End: Complemental strand, 8345407 - 8345012
Alignment:
| Q |
13 |
acaaacaacctttgaacggcgtcgctgttgaaattggtcctgtcatgggtgctgaatcatggcctgctttgtctgaatccgccaaaattcctggtaaatt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8345407 |
acaaacaacctttgaacggcgtcgctgttgaaattggtcctgtcatgggtgctgaatcatggcctgctttgtctgaatccgccaaaattcctggtaaatt |
8345308 |
T |
 |
| Q |
113 |
gccacccgaatcctcttcttcgaagattgctcctcctgctgctgctgttgatggatcaccttccacttctcaggttttgttctattactttccctaattt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8345307 |
gccacccgaatcctcttcttcgaagattgctcctcctgct---gctgttgatggatcaccttccacttctcaggttttgttctattactttccctaattt |
8345211 |
T |
 |
| Q |
213 |
tcttaaaatgannnnnnnnnncaggtatgttctctgtttactttctagagattaatgaattggatcaaaatatggtttatgaattgaaatgatagacaca |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8345210 |
tcttaaaatgattttttttttcaggtatgttctctgtttactttctagagattaatgaattggatcaaaatatggtttatgaattgaaatgatagacaca |
8345111 |
T |
 |
| Q |
313 |
ccgacatgacacacatacgcgtcgaaactagtaatt-nnnnnnnnngttcaattgattgtagtttcgttagagtaatttgattaatataactgactcca |
410 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8345110 |
ccgacatgacacacatacgcttcgaaactagtaattaaaaaaaaaagttcaattgattgtagtttcgttagagtaatttgattaatataactgactcca |
8345012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 6084150 - 6084186
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6084150 |
tagagattaatgagttggatcaaaatatggtttatga |
6084186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 475 - 514
Target Start/End: Complemental strand, 8344947 - 8344908
Alignment:
| Q |
475 |
catttgaggtatgaagtgattgtaagaggaatcctctctg |
514 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
8344947 |
catttgagttataaagtgattgtaagaggaatcctctctg |
8344908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Complemental strand, 990567 - 990529
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
990567 |
tctagagattaatgagttggatcaacatatggtttatga |
990529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 15438900 - 15438864
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| |
|
|
| T |
15438900 |
tagagattaatgagttagatcaaaatatggtttatga |
15438864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 1569189 - 1569227
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1569189 |
tctagagattaatgagttggatcaaaatatggtttatga |
1569227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 43282004 - 43282042
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43282004 |
tctagagattaatgagttggatcaaaatatggtttatga |
43282042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 45601649 - 45601687
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
45601649 |
tctagagattaatgagttggatcaaaatatgatttatga |
45601687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 36101881 - 36101848
Alignment:
| Q |
261 |
agattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |
|
|
| T |
36101881 |
agattaatgagttggatcaaaatatggtttatga |
36101848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 37976410 - 37976446
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
37976410 |
tagagattaatgagttggatccaaatatggtttatga |
37976446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 35; Significance: 0.0000000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 36304139 - 36304177
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36304139 |
tctagagattaatgagttggatcaaaatatggtttatga |
36304177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 44571602 - 44571638
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
44571602 |
tagagattaatgagttggatccaaatatggtttatga |
44571638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 45289198 - 45289162
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
45289198 |
tagagattaatgagttggatccaaatatggtttatga |
45289162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 54 - 98
Target Start/End: Original strand, 31755729 - 31755773
Alignment:
| Q |
54 |
gtcatgggtgctgaatcatggcctgctttgtctgaatccgccaaa |
98 |
Q |
| |
|
||||||| |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
31755729 |
gtcatggatgctgactcatggcctgctttatctgaatccgccaaa |
31755773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Complemental strand, 35643715 - 35643677
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
35643715 |
tctagagattaatgagttggatcgaaatatggtttatga |
35643677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 261 - 294
Target Start/End: Complemental strand, 33827861 - 33827828
Alignment:
| Q |
261 |
agattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
33827861 |
agattaatgaattggatctaaatatggtttatga |
33827828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 29520824 - 29520860
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
29520824 |
tagagattaatgagttggatccaaatatggtttatga |
29520860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 43904772 - 43904736
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
43904772 |
tagagattaatgagttggatctaaatatggtttatga |
43904736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 258 - 297
Target Start/End: Original strand, 41894241 - 41894280
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatgaatt |
297 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
41894241 |
tagagattaatgagttggatccaaatatggtttatgaatt |
41894280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 20367066 - 20367104
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
20367066 |
tctagagattaatgagttggatccaaatatggtttatga |
20367104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 5306469 - 5306507
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
5306469 |
tctagagattaatgagttggatccaaatatggtttatga |
5306507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 256 - 294
Target Start/End: Original strand, 25574997 - 25575035
Alignment:
| Q |
256 |
tctagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25574997 |
tctagagattaatgagttggatcgaaatatggtttatga |
25575035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 30480298 - 30480334
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30480298 |
tagagattaatgaattggactaaaatatggtttatga |
30480334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 34208376 - 34208340
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34208376 |
tagagattaatgagttggatccaaatatggtttatga |
34208340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000007; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 11412882 - 11412918
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
11412882 |
tagagattaatgagttggatccaaatatggtttatga |
11412918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 258 - 294
Target Start/End: Complemental strand, 19337000 - 19336964
Alignment:
| Q |
258 |
tagagattaatgaattggatcaaaatatggtttatga |
294 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
19337000 |
tagagattaatgagttggatcgaaatatggtttatga |
19336964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University