View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12830_high_5 (Length: 347)
Name: NF12830_high_5
Description: NF12830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12830_high_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 14616535 - 14616206
Alignment:
| Q |
1 |
gtgggacccactctgggaccaggaattgcctgtgtaactgaaccggtgaattcaacaaggtcaagagccttttcttgaatccatggaagttcttcttcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14616535 |
gtgggacccactctgggaccaggaattgcctgtgtaactgaaccggtgaattcaacaaggtcaagagccttttcttgaatccatggaagttcttcttcaa |
14616436 |
T |
 |
| Q |
101 |
cttcaacttcaacaatttcttctttagattgattattagggttagtattgttggaagagtttttggatgatgatgctgaagcgacggttgagattgaaag |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14616435 |
cttcaacttcaataatttcttctttagattgattattagggttagtattgttggaagagtttttggatgatgatgctgaagcgacggttgagattgaaag |
14616336 |
T |
 |
| Q |
201 |
ttttgggtggagtttagggaatgataagggtggatgagattggaaatggattagggatggggttttgttagggagagagaggaagggagaagtgagagaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14616335 |
ttttgggtggagtttagggaatgataagggtggatgagattggaaatgggttagggatggggttttgttagggagagagaggaagggagaagtgagagaa |
14616236 |
T |
 |
| Q |
301 |
gatgaagtgaaagccattggatatagtttg |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14616235 |
gatgaagtgaaagccattggatatagtttg |
14616206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University