View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12830_low_11 (Length: 213)
Name: NF12830_low_11
Description: NF12830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12830_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 37172966 - 37173085
Alignment:
| Q |
17 |
agttgcaacactaaatcgaagcatccctcaccgagcaacgaagaaagggttcgactttagatgtggcagatttgagtgtttgagatattctagtagactc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37172966 |
agttgcaacactaaatcgaagcatccctcaccgagcaacgaagaaagggttcgactttagatgtggcagatttgactgtttgagatattctagtagactc |
37173065 |
T |
|
| Q |
117 |
atccattgctatggccaact |
136 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
37173066 |
atccattgctatggccaact |
37173085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University