View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12830_low_11 (Length: 213)

Name: NF12830_low_11
Description: NF12830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12830_low_11
NF12830_low_11
[»] chr8 (1 HSPs)
chr8 (17-136)||(37172966-37173085)


Alignment Details
Target: chr8 (Bit Score: 116; Significance: 3e-59; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 116; E-Value: 3e-59
Query Start/End: Original strand, 17 - 136
Target Start/End: Original strand, 37172966 - 37173085
Alignment:
17 agttgcaacactaaatcgaagcatccctcaccgagcaacgaagaaagggttcgactttagatgtggcagatttgagtgtttgagatattctagtagactc 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
37172966 agttgcaacactaaatcgaagcatccctcaccgagcaacgaagaaagggttcgactttagatgtggcagatttgactgtttgagatattctagtagactc 37173065  T
117 atccattgctatggccaact 136  Q
    ||||||||||||||||||||    
37173066 atccattgctatggccaact 37173085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University