View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12830_low_5 (Length: 366)
Name: NF12830_low_5
Description: NF12830
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12830_low_5 |
 |  |
|
| [»] scaffold0179 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 894663 - 894838
Alignment:
| Q |
1 |
taatatgcaatatccctaccaactaaaataagttattttgcctttatttatatgtatagatgatcatacgtctgcgacacaatattcaacttaattagca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
894663 |
taatatgcaatatccctaccaactaaaataagttattttgcctttatttataggtacagatgatcatgcgtctgcgacacaatattcaacttaattagca |
894762 |
T |
 |
| Q |
101 |
ccatcttcgaattaatttgttatgattgattcccccaaacaaccatctcttccttgtcttgctggctttccttctc |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894763 |
ccatcttcgaattaatttgttatgattgattcccccaaacaaccatctcttccttgtcttgctggctttccttctc |
894838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 264 - 310
Target Start/End: Original strand, 894908 - 894954
Alignment:
| Q |
264 |
ggttgtaaatccccatatttcaagtcacgttgtaggtcaatctccac |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
894908 |
ggttgtaaatccccatatttcaagtcacgttgtaggtcaatctccac |
894954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 5944465 - 5944434
Alignment:
| Q |
1 |
taatatgcaatatccctaccaactaaaataag |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5944465 |
taatatgcaatatccctaccaactaaaataag |
5944434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 84; Significance: 8e-40; HSPs: 2)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 37 - 148
Target Start/End: Complemental strand, 5637 - 5526
Alignment:
| Q |
37 |
tttgcctttatttatatgtatagatgatcatacgtctgcgacacaatattcaacttaattagcaccatcttcgaattaatttgttatgattgattccccc |
136 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || |||||||||| |||||||||||||||| |||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
5637 |
tttgcctttatttataagtatagatgatcatgcggctgcgacacagtattcaacttaattaggaccatcttcgtattaatttgttatgatcgattccccc |
5538 |
T |
 |
| Q |
137 |
aaacaaccatct |
148 |
Q |
| |
|
|||||||||||| |
|
|
| T |
5537 |
aaacaaccatct |
5526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 264 - 310
Target Start/End: Complemental strand, 5454 - 5408
Alignment:
| Q |
264 |
ggttgtaaatccccatatttcaagtcacgttgtaggtcaatctccac |
310 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
5454 |
ggttgtaaatccccatatttcaagccacgttgtaagtcaatctccac |
5408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University