View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12831_low_4 (Length: 364)
Name: NF12831_low_4
Description: NF12831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12831_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 293
Target Start/End: Complemental strand, 43961263 - 43960987
Alignment:
| Q |
16 |
aaaaacaagtgtcttgatcatgtagttgacattcaattaacgttgtaagagaaagagagattacggagtnnnnnnn-tgtttgcgaaaggggggaccatc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43961263 |
aaaaacaagtgtcttgatcatgtagttgacattcaattaacgttgtaagaga--gagagattacggagtaaaaaaaatgtttgcgaaaggggggaccatc |
43961166 |
T |
 |
| Q |
115 |
gattaagagagcgcaaagaagagtagtaagcatgagagctccataagcaccaaacagaggtctcaaacccgtcgtcattgtcagagaccggaggagaata |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43961165 |
gattaagagagcgcaaagaagagtagtaagcatgagagctccataagcaccaaacagaggtctcaaacccgtcgtcattgtcagagaccggaggagaata |
43961066 |
T |
 |
| Q |
215 |
aattcatcaaagaaaatcgtctactcttgattcaacaattgcaagagtatagatgttctcacaggtgttttgctacttg |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43961065 |
aattcatcaaagaaaatcgtctactcttgattcaacaattgcaagagtatagatgttctcgtaggtgttttgctacttg |
43960987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 314 - 360
Target Start/End: Complemental strand, 43960978 - 43960932
Alignment:
| Q |
314 |
atccaaaactctcacctataaatatcttcatacacattcttctcact |
360 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
43960978 |
atccaaaactctcacctataaatatcttcatacacattcttttcact |
43960932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University