View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_high_10 (Length: 322)
Name: NF12832_high_10
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 19 - 311
Target Start/End: Complemental strand, 9401728 - 9401437
Alignment:
| Q |
19 |
ttaaacactgcattcaagggctgaattggaaaccatgcttttaaaataatttgattctcattttgtttattgataattaattgatttcagacagtacaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9401728 |
ttaaacactgcattcaagggctgaattggaaaccatgcttttaaaata-tttgattctcattttgtttattgataattaattgatttcagacagtacaat |
9401630 |
T |
 |
| Q |
119 |
ctataatggaattatcgtttcagattctaattcaagtgaatggcatatgggaatatgccaaaactatcctgatacgttgttttggtcccgtgccacacac |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9401629 |
ctataatggaattatcgtttcagattctaattcaagtgaatggcatatgggaatatgccgaaactatcctgatacgttgtattggtcccgtgccacacac |
9401530 |
T |
 |
| Q |
219 |
tttttccaaatgttacgtttctgtcgacaaaactaaattatacccgagaaaagggtgagatcttttgcccccaccttttgttgctccagtgaa |
311 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9401529 |
tttttgcaaatgttacgtttctgtcgacaagactaaattatacccgagaaaagggtgagatcttttgcccccaccttttgttgctccagtgaa |
9401437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University