View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_high_12 (Length: 312)
Name: NF12832_high_12
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_high_12 |
 |  |
|
| [»] scaffold0576 (1 HSPs) |
 |  |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0459 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
| [»] scaffold1175 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (2 HSPs) |
 |  |  |
|
| [»] scaffold0068 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0623 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 44)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 38 - 287
Target Start/End: Complemental strand, 9401119 - 9400885
Alignment:
| Q |
38 |
taattgaaattgaccggcatcaggggaaccagtcatgtacgtaactcatggagtcaatacttgacagtgatatacagagcttgctctgagctctgacttt |
137 |
Q |
| |
|
||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
9401119 |
taattgaaattgaccagcatcagaggaacaagtcatgtacgtaactcatggagtcaatacttgacagtgat-----------------agctctggcttt |
9401037 |
T |
 |
| Q |
138 |
aaac-ggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt-cnnnnnnnnnnnnnnntacttga |
235 |
Q |
| |
|
|||| ||| |||| ||| ||||| ||||||||| | |||| ||||||| |||||||||||||||||| ||||||| ||||||| |
|
|
| T |
9401036 |
aaacagggcccccgcaagtgggcagtgggattggtttccttagattagtcgattcttggatcggatactgagttttaaaaaaaaaaaaaaaaatacttga |
9400937 |
T |
 |
| Q |
236 |
cagtgaaaaatgagtcctcgttgttgaatgtgaatgatttaacttaactatt |
287 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9400936 |
cagtgaaaaatgagtcctcattgttgaatgtgaatgatttaacttaactatt |
9400885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 33827659 - 33827572
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33827659 |
gctctggctttaaacgggacccctgcaagtgggcggtgggattggtccccttggattagtcgattcttggatcggataccgagttttc |
33827572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 28668991 - 28669071
Alignment:
| Q |
134 |
ctttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||| |||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
28668991 |
ctttaaacggggcccccacaagtgggcggtgggattggtcccctcggattagtcgatttttggatcggataccgagttttc |
28669071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 35171911 - 35171998
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
35171911 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagttttc |
35171998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 44946139 - 44946052
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44946139 |
gctctggctttaaacgggccccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
44946052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 11941296 - 11941210
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
11941296 |
gctctggctttaaacgggacccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
11941210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 126 - 212
Target Start/End: Original strand, 25293268 - 25293356
Alignment:
| Q |
126 |
agctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| |||||||||||||||| | || |||||| |||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
25293268 |
agctctggctttaaacggggccccccgcaagtgggcgatgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
25293356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 18692091 - 18692158
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
18692091 |
ccccacaagtgggcggtgggattggtcccctcgtattagtcgattcttggatcggataccgagttttc |
18692158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 34516492 - 34516413
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||| ||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
34516492 |
ctttaaacgggcccctgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccaagttttc |
34516413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 27269401 - 27269344
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
27269401 |
tgggcggtgggattgatcccctcggattagtcgattcttggataggataccgagtttt |
27269344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 15038077 - 15038157
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15038077 |
ctttaaacggagcccccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagttttc |
15038157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 2140552 - 2140485
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
2140552 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagttttc |
2140485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 3943851 - 3943938
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| |||| |||||||||| ||||||||||||||| | || |||||||||||||| ||||||| |
|
|
| T |
3943851 |
gctctggctttaaacggggctcccgcaagtgggtggtgggattggtccccttggattagtcggttattggatcggataccaagttttc |
3943938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 205
Target Start/End: Complemental strand, 36242398 - 36242319
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggatacc |
205 |
Q |
| |
|
|||||| |||||||||||| |||| ||| ||||||||||||||| |||||| |||||| | ||||||||||||||||||| |
|
|
| T |
36242398 |
gctctggctttaaacggggtccccgcaagtgggcggtgggattggtcccctcggattaatcgattcttggatcggatacc |
36242319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 24196115 - 24196200
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| |||| || ||| ||||||||||||||| |
|
|
| T |
24196115 |
gctctggctttaaacggg-ccccgcaagtgggcggtgggattggtcccctcggattagtcgattttttgattggataccgagttttc |
24196200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 30466916 - 30466830
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||||| ||||||||| |||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
30466916 |
gctctggctttaaaccgggcccccgcaagtgggcagtgggattggtcccttcggattagtcgattcttggatcggataccgagtttt |
30466830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 44929912 - 44929846
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||| ||||||||||| |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
44929912 |
ccccgcaagtggacggtgggattggtccccttgaattagtcgattcttggatcggataccgagtttt |
44929846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 139 - 213
Target Start/End: Original strand, 14486948 - 14487023
Alignment:
| Q |
139 |
aacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||| ||| ||||||||||||||| |||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
14486948 |
aacggggcccctgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttc |
14487023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 18976521 - 18976454
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| | |||||| ||||||||||||||||||||| ||||| |
|
|
| T |
18976521 |
ccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgaattttc |
18976454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 19054157 - 19054224
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| ||| || |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
19054157 |
ccccgcaagtgggcggtgggattggtccgctcggattagtcgattcttggatcagataccgagttttc |
19054224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 213
Target Start/End: Complemental strand, 43374384 - 43374329
Alignment:
| Q |
158 |
gcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||| |||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43374384 |
gcggtgggattggtcccttcggattagtcgattcttggatcggataccgagttttc |
43374329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 714211 - 714125
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||| || |||||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
714211 |
gctctgactttaaacggagcccccgcaaatgggcggtgggtttcgtcccctcagattagtcgattcttagattggataccgagtttt |
714125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 29361667 - 29361745
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||| ||||| ||| ||||| |||||||||||| ||| |||||| | ||||| ||||||||||| |||||||| |
|
|
| T |
29361667 |
ctttaaacggagccccgcaagtgggcagtgggattgatctcctcggattaattgattcctggatcggatatcgagtttt |
29361745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 41314103 - 41314189
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||||| ||| ||| ||| ||||||||||| |||||| ||||| | ||||||| ||||||||||| ||||||| |
|
|
| T |
41314103 |
gctctgactttaaacgggatcccgcaagtggacggtgggattggtcccctcagattaatcgattcttcgatcggataccaagttttc |
41314189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 41329953 - 41330039
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||| |||||||| |||| ||||||||| ||||| |||||| ||||||| | |||||||| ||||||||||||||| |
|
|
| T |
41329953 |
gctctggctttaaatggggcccccacaagtgggcggtgagattggtcccctcagattagtcggttcttggaccggataccgagtttt |
41330039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 135 - 212
Target Start/End: Original strand, 4852649 - 4852726
Alignment:
| Q |
135 |
tttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| ||| ||| |||||| |||| |||||| |||||| | |||||||||||||||| || |||||| |
|
|
| T |
4852649 |
tttaaacggggccccgcaagtggacggtggaattggtcccctcggattaatcgattcttggatcggatgccaagtttt |
4852726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 13266601 - 13266686
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||| |||||||| |||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
13266601 |
gctctggctttaaacggggccccgcaagtgggtaatgggattggtcccctcaaattagtcgattcttggatcggatatcgagtttt |
13266686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 19174886 - 19174959
Alignment:
| Q |
139 |
aacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||||| |||||| | | | ||||||||||||||||| |||| |
|
|
| T |
19174886 |
aacggagccccgtaaatgggcggtgggattgatcccctcggattaatcggtccttggatcggataccgaatttt |
19174959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 126 - 205
Target Start/End: Original strand, 45132397 - 45132477
Alignment:
| Q |
126 |
agctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggatacc |
205 |
Q |
| |
|
||||||| |||||||||||||||| |||| ||||| || |||||| ||| || |||||| | ||||||||||||||||||| |
|
|
| T |
45132397 |
agctctggctttaaacggggcccccacaagtgggcagtaggattggtcctctcggattaatcgattcttggatcggatacc |
45132477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 208
Target Start/End: Complemental strand, 5608120 - 5608038
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgag |
208 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||| |||||||||||| | ||| ||| |||| ||| ||||||||||||| |
|
|
| T |
5608120 |
gctctgactttaaacggagctcccacaaatggtcggcgggattgatcccttcagatgagtcgattattgaatcggataccgag |
5608038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Complemental strand, 8192409 - 8192351
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||| ||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
8192409 |
tgggcggtgggattgggcccctcggattagtcggtccttggatcggataccgagttttc |
8192351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 27290730 - 27290772
Alignment:
| Q |
171 |
tccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27290730 |
tcccctcggattagtcgattcttggatcggataccgagttttc |
27290772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 39957898 - 39957956
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| | |||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
39957898 |
tgggcgatgggattggttccctcggattagtcgattcttggattggataccgagttttc |
39957956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 5 - 46
Target Start/End: Complemental strand, 9401427 - 9401386
Alignment:
| Q |
5 |
acactattgggagctaaggtaagtaacttatcgtaattgaaa |
46 |
Q |
| |
|
|||| |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9401427 |
acaccattgggagctaaggtaagtaacttattgtaattgaaa |
9401386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 17324877 - 17324961
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||| ||| |||||||| |||||||||||||| |||||| |||||| ||||||| ||||||||| |||||||| |
|
|
| T |
17324877 |
gctctggctttaaatgggcccccacaagtgggcggtgggattagtcccctcaaattagtcgattctt-gatcggatatcgagtttt |
17324961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 193
Target Start/End: Complemental strand, 44976240 - 44976172
Alignment:
| Q |
127 |
gctctgactttaaacggggc--cccacaaatgggcggtgggattgatccccttggattagtagattctt |
193 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| |||||||||||||||||||| | |||||||| ||||||| |
|
|
| T |
44976240 |
gctctggctttaaacggggctccccgcaagtgggcggtgggattgatcccttcggattagtcgattctt |
44976172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 5394128 - 5394215
Alignment:
| Q |
127 |
gctctgactttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||| |||||| || ||| ||||||||||||||| ||| | |||||||| | | ||| ||||||||||||| ||||| |
|
|
| T |
5394128 |
gctctgactttaaatggggccgccgcaagtgggcggtgggattggtccgttcggattagtcggtccttagatcggataccgaattttc |
5394215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 44610157 - 44610236
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||| |||| | |||||||| | |||||||| || |||||||||||| |
|
|
| T |
44610157 |
ctttaaatggggcccctgcaagtgggcggtgggattggtcccatcggattagtcggttcttggaccgaataccgagtttt |
44610236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 19605916 - 19605846
Alignment:
| Q |
142 |
ggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||||||| ||||||||| ||||| |||||| | |||||| || ||||||||||||| |||||||| |
|
|
| T |
19605916 |
gggggcccacaagtgggcggtgagattggtcccctcgaattagttgacacttggatcggatatcgagtttt |
19605846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 36390654 - 36390569
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||| ||| |||| ||| ||||||||||||||| |||| | |||| ||| ||| |||| ||||||||||||||||| |
|
|
| T |
36390654 |
gctctgactttaaatgggacccccgcaagtgggcggtgggattggtccc-tcggatcagtcgatacttgaatcggataccgagtttt |
36390569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 164 - 213
Target Start/End: Complemental strand, 1501511 - 1501463
Alignment:
| Q |
164 |
ggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1501511 |
ggattggtcccctcggattagtcgattcttg-atcggataccgagttttc |
1501463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 8259010 - 8259095
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||| ||||||||| ||| | |||||||||||| | || | |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
8259010 |
tctggctttaatcggggcccccgcaagtaggcggtgggattagttccttcggattagtcgattcttggatcggatactgagttttc |
8259095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 13599410 - 13599325
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||| ||||||||||| ||| ||| ||||| |||||||||||| |||||| | | |||||||||||||||| |||| |
|
|
| T |
13599410 |
gctctgacttagaacggggccccgcaagtggacggtgagattgatcccctcatattagtgggtcattggatcggataccgaatttt |
13599325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 4567480 - 4567428
Alignment:
| Q |
161 |
gtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||| ||| || |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
4567480 |
gtgggattggtcctctcggattagtcaattcttggatcggatacccagttttc |
4567428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 63; Significance: 2e-27; HSPs: 28)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 3222721 - 3222635
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3222721 |
gctctgtctttaaacggggccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
3222635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 21148596 - 21148510
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
21148596 |
gctctgactttaaacggggccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagttttc |
21148510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 15360184 - 15360097
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15360184 |
gctctggctttaaacggggcccccgcaaatgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
15360097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 1345046 - 1345133
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1345046 |
gctctggctttaaacgggccccccgcaagtggacggtgggattggtccccttggattagtcgattcttggatcggataccgagttttc |
1345133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 34147457 - 34147544
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34147457 |
gctctggctttaaacgggccccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
34147544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 34160073 - 34160160
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34160073 |
gctctggctttaaacgggccccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
34160160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 654232 - 654146
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| ||||||||||||||| |||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
654232 |
gctctggctttaaacggggctcccgcaagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagtttt |
654146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 9690724 - 9690638
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||| ||||||||||| ||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
9690724 |
gctctggctttaaacggggccctcacaagtggacggtgggattggtcctctcggattagtcgattcttggatcggataccgagtttt |
9690638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 21982406 - 21982320
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21982406 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtccc-tcggattagtcgattcttggatcggataccgagttttc |
21982320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 5360157 - 5360071
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||| |||| |||| ||||||||||||||| |||||| | |||||| ||||||| |||||||||||||||||| |
|
|
| T |
5360157 |
gctctgactttaaacggaacccccacaagtgggcggtgggattggtcccctcgaattagtcgattcttagatcggataccgagtttt |
5360071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 134 - 211
Target Start/End: Original strand, 9239093 - 9239171
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
||||||| |||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
9239093 |
ctttaaatggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
9239171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 11448982 - 11449068
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||| |||||||| |||||||| |
|
|
| T |
11448982 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggatatcgagtttt |
11449068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 14213000 - 14213080
Alignment:
| Q |
134 |
ctttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||| |||| ||| |||| |||||||||| ||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14213000 |
ctttaaacgggggccccgcaagtgggtggtgggattggtccactcggattagtcgattcttggatcggataccgagttttc |
14213080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 28672185 - 28672264
Alignment:
| Q |
134 |
ctttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| ||| | ||| ||||||||||||||| |||||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
28672185 |
ctttaaacgggcccctcgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagtttt |
28672264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 9844051 - 9844136
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||||||| ||||| |||| | |||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
9844051 |
tctggctttaaacggggccccctcaagtgggcggtgagattggtcccttcggattagtcgattcttggatcggatatcgagttttc |
9844136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 135 - 212
Target Start/End: Original strand, 11841020 - 11841097
Alignment:
| Q |
135 |
tttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||| || ||| |||||||||| |||||| | |||||| |||| ||||||||||||||||||||| |
|
|
| T |
11841020 |
tttaaacggggccccataagtggacggtgggattagtcccctcgaattagtcgattattggatcggataccgagtttt |
11841097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 17081140 - 17081053
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||| |||||| | || ||| | ||||||||||| ||||||||||||| |
|
|
| T |
17081140 |
gctctgactttaaatggggcccccgcaagtgggcggtgggattggtcccctcgaataagttgtttcttggatcgaataccgagttttc |
17081053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 139 - 212
Target Start/End: Original strand, 17225790 - 17225863
Alignment:
| Q |
139 |
aacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||| ||||||| | | ||| ||||||||| |||||||| |
|
|
| T |
17225790 |
aacggggccccgcaaatgggcggtgggattgatctcctcagattagtcggtccttagatcggatatcgagtttt |
17225863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 135 - 203
Target Start/End: Complemental strand, 33718547 - 33718478
Alignment:
| Q |
135 |
tttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggata |
203 |
Q |
| |
|
||||||||||||| | ||| ||| |||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
33718547 |
tttaaacggggcctctgcaagtggacggtgggattgatcccctcggattagtcgattcttggatcggata |
33718478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 11007283 - 11007363
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||||||||| ||||| |||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
11007283 |
ctttaagcggggcccccgcaagtgggcggtgggattggccccctcggattagtcgattctttgatcggatacctagttttc |
11007363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 129 - 212
Target Start/End: Complemental strand, 15730579 - 15730495
Alignment:
| Q |
129 |
tctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||||||||| |||||| ||| ||||||||||||||| || ||| |||||||| ||||||| ||||||||| |||||||| |
|
|
| T |
15730579 |
tctggctttaaacgtggcccccacacgtgggcggtgggattggtcacctcggattagtcgattctttgatcggatatcgagtttt |
15730495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 210
Target Start/End: Original strand, 10377826 - 10377911
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc--acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtt |
210 |
Q |
| |
|
|||||||||| |||||||||||| |||| |||||||||| |||| |||||| ||| |||| | | ||||||| |||||||||||| |
|
|
| T |
10377826 |
gctctgacttaaaacggggccccccacaagtgggcggtggcattggtcccctcggagtagtcggtccttggattggataccgagtt |
10377911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 14504148 - 14504082
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||||||||||||||||||| || | |||||| ||| |||| ||||||||||||||||| |
|
|
| T |
14504148 |
ccccgcaagtgggcggtgggattgatcctctcgaattagtcgatccttgtatcggataccgagtttt |
14504082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 109 - 213
Target Start/End: Complemental strand, 21903724 - 21903618
Alignment:
| Q |
109 |
atacagagctt-gctctgagctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttg-gattagtagattcttggatcggatacc |
205 |
Q |
| |
|
||||||||||| |||||| |||||| ||||||| ||||| ||| ||| |||||||||||| || ||||| | ||||||| |||||||||||||||| | |
|
|
| T |
21903724 |
atacagagctttgctctg-gctctggctttaaatggggcaccagcaagtgggcggtgggaatggtccccctcagattagtcgattcttggatcggatgca |
21903626 |
T |
 |
| Q |
206 |
gagttttc |
213 |
Q |
| |
|
|||||||| |
|
|
| T |
21903625 |
gagttttc |
21903618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 212
Target Start/End: Original strand, 4797256 - 4797294
Alignment:
| Q |
174 |
ccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
4797256 |
ccttggattagtcgattcttggatcggataacgagtttt |
4797294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 180 - 213
Target Start/End: Complemental strand, 7491698 - 7491665
Alignment:
| Q |
180 |
attagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
7491698 |
attagtcgattcttggatcggataccgagttttc |
7491665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 12390536 - 12390620
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||||||||||||||| |||||| |||||||| || || |||||||||||||||||| |
|
|
| T |
12390536 |
gctctggctttaaacagggcccccgcaagtgggcggtgggattggtcccctcggattagtcga---ttaaatcggataccgagttttc |
12390620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 33499608 - 33499672
Alignment:
| Q |
148 |
ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||||||| |||||| |||||||| || |||| ||||||||||||||| |
|
|
| T |
33499608 |
ccacaagtgggcggtgggattggtcccctcggattagtcagttgatggaccggataccgagtttt |
33499672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 47)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 19456296 - 19456210
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19456296 |
gctctggctttaaacggggccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
19456210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 41351189 - 41351103
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||| || ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41351189 |
gctctggctttaaacggggctccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
41351103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 7085712 - 7085625
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
7085712 |
gctctgactttaaacggggtccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagttttc |
7085625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 8484747 - 8484660
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8484747 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
8484660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 27498817 - 27498730
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27498817 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
27498730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 125 - 213
Target Start/End: Complemental strand, 33709591 - 33709502
Alignment:
| Q |
125 |
gagctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||| ||||||||||| |||| |||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
33709591 |
gagctctggctttaaacgggacccccacaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgtgttttc |
33709502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 135 - 212
Target Start/End: Original strand, 22693054 - 22693132
Alignment:
| Q |
135 |
tttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
22693054 |
tttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
22693132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 38684319 - 38684405
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| || |||||||||||| |||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
38684319 |
gctctggctttaaacgggcccccgcaagtgagcggtgggattggtcccctcggattagtcgattcttggatcggataccgatttttc |
38684405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 18207320 - 18207405
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||||||||| |||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18207320 |
tctggctttaaacgaggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
18207405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 11926588 - 11926501
Alignment:
| Q |
127 |
gctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| | || |||| |||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
11926588 |
gctctggctttaaacggggccccccgcaagtgggtggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
11926501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 128 - 207
Target Start/End: Complemental strand, 11464992 - 11464913
Alignment:
| Q |
128 |
ctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccga |
207 |
Q |
| |
|
||||| |||||||||||||||| ||| |||| |||||||||| |||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
11464992 |
ctctggctttaaacggggccccgcaagtgggtggtgggattggtcccctcgaattagtcgattcttggatcggataccga |
11464913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 15641191 - 15641105
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
15641191 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattctt-gatcggataccgagttttc |
15641105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 129 - 212
Target Start/End: Complemental strand, 28614569 - 28614486
Alignment:
| Q |
129 |
tctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||| ||| || |||| |||||||||||||||||| | |||||| |||| ||||||||||||||||||||| |
|
|
| T |
28614569 |
tctgactttaaacgggatcccgcagatggacggtgggattgatcccctcgaattagtcgatttttggatcggataccgagtttt |
28614486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 32059526 - 32059439
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
32059526 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttc |
32059439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 35425124 - 35425211
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| ||| || |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
35425124 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcctctcggattagtcgattcttggatcggataccgaattttc |
35425211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 131 - 212
Target Start/End: Complemental strand, 13659327 - 13659245
Alignment:
| Q |
131 |
tgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||||||||||||||| |||||| | ||||||||||||||||||||| |||| |
|
|
| T |
13659327 |
tgactttaaacgggacccccgcaagtgggcggtgggattgatcccctcggattaatcgattcttggatcggataccgaatttt |
13659245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 128 - 213
Target Start/End: Complemental strand, 21236447 - 21236361
Alignment:
| Q |
128 |
ctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||| |||||| ||||||| |||||||| |||||||||||||||||| |
|
|
| T |
21236447 |
ctctgactttaaacggggcccccgcaagtgggcggtgggattagtcccctcagattagtcgattcttgaatcggataccgagttttc |
21236361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 37495194 - 37495252
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37495194 |
tgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
37495252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 19145497 - 19145412
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||| || |||| ||| ||||||||||||||| |||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
19145497 |
gctctggctttaaatggtcccccgcaagtgggcggtgggattggtcccctcggattagttggttcttggatcggataccgagtttt |
19145412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 129 - 204
Target Start/End: Complemental strand, 13108534 - 13108458
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
|||| |||||||||||||||| ||| |||||||||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
13108534 |
tctgcctttaaacggggcccccgcaagtgggcggtgggattgatcccctcgaattagtcgattcttggatcggatac |
13108458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 4603888 - 4603975
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||| ||||||||||| |||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
4603888 |
gctctggctttaaacggggcccctgcaagtggacggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttc |
4603975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 10869651 - 10869564
Alignment:
| Q |
127 |
gctctgactttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||| || ||| ||||||||||||||| |||||| |||||||| | ||||||||||||||||| ||||||| |
|
|
| T |
10869651 |
gctctggctttaaatggggcctccgcaagtgggcggtgggattggtcccctcggattagtcggttcttggatcggataccaagttttc |
10869564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 13038534 - 13038463
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| | |||||| |||||||||||||||||| |
|
|
| T |
13038534 |
ctttaaacggggcccccgcaagtgggcggtgggattgatcccctcgaattagtcgattcttggatcggatac |
13038463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 22392799 - 22392886
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||| |||| |||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
22392799 |
gctctggctttaaacggggcccccgcaagtgggcggtggaattggtcccctcagattagtcgatttttggatcggataccgagttttc |
22392886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 30485959 - 30486026
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
30485959 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcaattcttggatcggataccgagttttc |
30486026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 38631045 - 38630978
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
38631045 |
ccccgcaagtgggcggtgggattggtcccctcggattaatcgattcttggatcggataccgagttttc |
38630978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 5049248 - 5049333
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| ||||||||||| |||| | | |||||| ||||||||||||| ||||| |||||| |
|
|
| T |
5049248 |
gctctggctttaaacgggcccccgcaaatggacggtgggattggtcccatcgaattagtcgattcttggatcgaataccaagtttt |
5049333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 27487611 - 27487554
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27487611 |
tgggcggtgggattggtcccctcggattagtcgattcttggatcggatacagagtttt |
27487554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 10631340 - 10631288
Alignment:
| Q |
161 |
gtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10631340 |
gtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
10631288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 23270601 - 23270522
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||| ||||| ||||||| ||||||||||| |||||| |||||||| ||||||||||| ||||||| |||||| |
|
|
| T |
23270601 |
ctttaaacggagcccccgcaaatggacggtgggattggtcccctcggattagttgattcttggattggataccaagtttt |
23270522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 131 - 213
Target Start/End: Complemental strand, 31288028 - 31287945
Alignment:
| Q |
131 |
tgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||| || ||| | |||||| | |||||||| |||||||||||||||| |
|
|
| T |
31288028 |
tgactttaaacggggcccccgcaagtgggcggtgggattggtctcctcgaattagtcggttcttggaccggataccgagttttc |
31287945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 34310253 - 34310339
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| |||| | || ||| ||||||||||| |||||| | |||| | |||||||||||||||||||||||||| |
|
|
| T |
34310253 |
gctctggctttaaacgggacccccataagtggacggtgggattggtcccctcgaattaatcgattcttggatcggataccgagtttt |
34310339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 12317240 - 12317154
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||| |||| |||| ||| |||| ||||||||||||||| | |||||||| |||||| ||||||||||||||||||| |
|
|
| T |
12317240 |
gctctgactttaagcgggccccccgcaagtgggtggtgggattgatccc-tcggattagtcaattcttagatcggataccgagttttc |
12317154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 6014366 - 6014280
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||| || | ||| ||||||||| |||| |||||| | |||||| ||||||||||||||||| |||||||| |
|
|
| T |
6014366 |
gctctggctttaaacggggtccacgcaagtgggcggtgagattagtcccctcgaattagtcgattcttggatcggatatcgagtttt |
6014280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 9659377 - 9659311
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||| ||||||||||| |||| | |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
9659377 |
ccccgcaagtggacggtgggattggtcccttcggattagttgattcttggatgggataccgagtttt |
9659311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 34049922 - 34050008
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||| |||| |||||| |||||| |||||||| |||||| ||||||||||||||||| |
|
|
| T |
34049922 |
gctctggctttaaacggggcccccgcaagtggtcggtaggattggtcccctcggattagttgattctcaaatcggataccgagtttt |
34050008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 42006873 - 42006931
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
42006873 |
tgggcggtggaattgttccacttggattagttgattctttgatcggataccgaattttc |
42006931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 201
Target Start/End: Original strand, 5067390 - 5067447
Alignment:
| Q |
144 |
ggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcgga |
201 |
Q |
| |
|
|||||| ||| ||||||||||||||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
5067390 |
ggccccgcaagtgggcggtgggattggtcccctctgattagtcgattcttggatcgga |
5067447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 10813936 - 10813851
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||| ||||||||||| | || ||||||||| ||||||||||||||| |||||| | || |||||||||||| |
|
|
| T |
10813936 |
gctctggctttaaacagggccccacaagtaggtggtgggatttgtccccttggattagtcagttcttgaaccgaataccgagtttt |
10813851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 41084123 - 41084180
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| ||||||||||| | |||||||| | |||||| ||||||||||||||||| |
|
|
| T |
41084123 |
tgggcggtaggattgatcccttcggattagtcggttcttgaatcggataccgagtttt |
41084180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 165 - 213
Target Start/End: Complemental strand, 3600045 - 3599997
Alignment:
| Q |
165 |
gattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| ||||||||| |||| |
|
|
| T |
3600045 |
gattgatcccctcggattagtcgattcttggatctgataccgagatttc |
3599997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 12398534 - 12398447
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| ||||||| ||||| ||||||||| || |||||| | ||||||||| ||||||||||||||| |
|
|
| T |
12398534 |
gctctggctttaaatggggcccccgcaaatggacggtgagattgatcctctcaaattagtcggttcttggattggataccgagttttc |
12398447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 166 - 212
Target Start/End: Original strand, 7151454 - 7151500
Alignment:
| Q |
166 |
attgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| |||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
7151454 |
attggtcccctagaattagtcgattcttggatcggataccgagtttt |
7151500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 33737882 - 33737939
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||| ||||| |||||| || ||||| |||||||| |||||||||||||||||| |
|
|
| T |
33737882 |
tgggcggtgagattggtcccctcgg-ttagttgattcttgaatcggataccgagttttc |
33737939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 183
Target Start/End: Complemental strand, 15971208 - 15971151
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggatta |
183 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||||||||| |||||||||||| |||||| |
|
|
| T |
15971208 |
gctctgactttaaacgggacccccgcaagtgggcggtgagattgatcccctcggatta |
15971151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 212
Target Start/End: Complemental strand, 25750646 - 25750613
Alignment:
| Q |
179 |
gattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
25750646 |
gattagtcgattcttggatcggataccgagtttt |
25750613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 36895565 - 36895622
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| ||||||| || ||| | |||||| | |||||||||||||||||||||||| |
|
|
| T |
36895565 |
tgggcggggggattgttctcctcgaattagtcggttcttggatcggataccgagtttt |
36895622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 59)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 24165800 - 24165714
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24165800 |
gctctggctttaaacggggccccgcaagtgggcggtgggattgttcccctcggattagtcgattcttggatcggataccgagttttc |
24165714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 49258348 - 49258262
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
49258348 |
gctctggctttaaacggggcccccacaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
49258262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 52821721 - 52821636
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| || ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
52821721 |
gctctggctttaaacggggccccgtaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
52821636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 8097365 - 8097278
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8097365 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
8097278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 10083905 - 10083818
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||| ||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10083905 |
gctctggctttaaacggggcccccacaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
10083818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 46576459 - 46576546
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||| |||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46576459 |
gctctggctttaaacggggcccccgcaagtgggcggtcggattggtccccttggattagtcgattcttggatcggataccgagttttc |
46576546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 15566585 - 15566499
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
15566585 |
gctctggctttaaacgggcccccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagttttc |
15566499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 24407372 - 24407458
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
24407372 |
gctctgactttaaacggggccatcgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
24407458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 10190828 - 10190741
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||| ||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10190828 |
gctctggctttaaacggggcccccgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
10190741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 40133535 - 40133448
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
40133535 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttttc |
40133448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 45272502 - 45272415
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
45272502 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagttgactcttggatcggataccgagttttc |
45272415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 53424255 - 53424176
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||| |||| ||| || |||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53424255 |
ctttaaacgggcccccgcaagtgagcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
53424176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 54475799 - 54475878
Alignment:
| Q |
134 |
ctttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||| || ||| ||||||||||||||| ||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
54475799 |
ctttaaacggggccaccgcaagtgggcggtgggattggtccccttggattagtcgattcttggatcagataccgagtttt |
54475878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 8456236 - 8456149
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| ||||||||| |||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
8456236 |
gctctggctttaaacggggcccccgcaagtgggcagtgggattggtcccctcggattagtcgattcttgaatcggataccgagttttc |
8456149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 26174244 - 26174311
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26174244 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
26174311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 48977499 - 48977586
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
48977499 |
gctctggctttaaacggggcccctgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttc |
48977586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 53848500 - 53848433
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
53848500 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
53848433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 1178283 - 1178368
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| ||||||||||| ||||||||||||||| |||| | |||||||| || |||||||||||||||||||||||| |
|
|
| T |
1178283 |
gctctggctttaaatggggccccacacgtgggcggtgggattggtccc-tcggattagtcgaatcttggatcggataccgagttttc |
1178368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 4462751 - 4462829
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||||||| || |||||||| |||||||||| |||||||||||||| |
|
|
| T |
4462751 |
ctttaaacggggccccgcaagtggacggtgggattgatccactcggattagtttattcttggattggataccgagtttt |
4462829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 18176973 - 18176887
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||| | |||||||| |||||||||||||||||| ||||||| |
|
|
| T |
18176973 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccatcggattagtcgattcttggatcggatacagagtttt |
18176887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 32151535 - 32151621
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||| ||||| |||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
32151535 |
gctctggctttaaacggggcccccgcaagtgggcggtgagattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
32151621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 35493022 - 35493108
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||| | |||||||||||| |
|
|
| T |
35493022 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggattgaataccgagtttt |
35493108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 39041938 - 39041852
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||| |||||||||| ||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
39041938 |
gctctggctttaaacggggcccccgcaagtgggtggtgggattggtccactcggattagtcgattcttggatcggataccgagtttt |
39041852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 25379872 - 25379957
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||| |||||| |||||||| |||||||||||||||||| |||||| |
|
|
| T |
25379872 |
gctctggctttaaacggggcccccgcaagcgggcggtgggattggtcccctcggattagtcgattcttggatcggatactgagttt |
25379957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 48104988 - 48105073
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||| ||||||| |||| ||||||||| ||||| |||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
48104988 |
gctctggctttaaacagggcccccacaagtgggcggtgagattggtcccttcggattagtcgattcttggatcggataccgagttt |
48105073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 2511383 - 2511296
Alignment:
| Q |
127 |
gctctgactttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||||| || || ||| ||||||||||||||| || ||| | ||||||||||||||| |||||||||| ||||||| |
|
|
| T |
2511383 |
gctctgactttaaacgggacctccgcaagtgggcggtgggattggtctcctcgaattagtagattcttgaatcggataccaagttttc |
2511296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 25289800 - 25289714
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||| | | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
25289800 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtccc-tcgaattagtcgattcttggatcggataccgagttttc |
25289714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 30257735 - 30257822
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| ||| |||||||||| |||| |||||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
30257735 |
gctctggctttaaatggggcccccgcaagtgggcggtggcattggtcccctcggattagtcgattcttggatcggataccgaattttc |
30257822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 45529840 - 45529754
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
45529840 |
gctctggctttaaacgggccccccgcaagtgggcggtgggattggtcccctcggattagtcgattctt-gatcggataccgagttttc |
45529754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 52455735 - 52455648
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||| ||| || |||||||||| |||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
52455735 |
gctctgactttaaacggggcccccgcaagtgactggtgggattggtcccctcggattagtcgattcttggattggataccgagttttc |
52455648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 53233996 - 53233910
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| || ||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
53233996 |
gctctggctctaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattctt-gatcggataccgagttttc |
53233910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 21363054 - 21363140
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||| ||||| ||| ||||||||||||||| | |||| |||||| | |||||||||||||||||||||||||| |
|
|
| T |
21363054 |
gctctggctttaaacggagcccccgcaagtgggcggtgggattggttccctcggattaatcgattcttggatcggataccgagtttt |
21363140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 212
Target Start/End: Complemental strand, 50731323 - 50731237
Alignment:
| Q |
126 |
agctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| || ||| || ||||| ||||||||||||||| |||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
50731323 |
agctctgacttataaggggcccacacaagtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagtttt |
50731237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 126 - 212
Target Start/End: Original strand, 50781531 - 50781617
Alignment:
| Q |
126 |
agctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| || ||| || ||||| ||||||||||||||| |||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
50781531 |
agctctgacttataaggggcccacacaagtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagtttt |
50781617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 4048094 - 4048147
Alignment:
| Q |
159 |
cggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
4048094 |
cggtgggattggtcccctcggattagttgattcttggatcggataccgagtttt |
4048147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 30807239 - 30807152
Alignment:
| Q |
127 |
gctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| | || |||||||| |||||| |||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
30807239 |
gctctggctttaaacggggccccccgcaagtgggcggtaggattggtccc-tcggattagtcgattcttggatcggataccgagttttc |
30807152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 6041757 - 6041670
Alignment:
| Q |
127 |
gctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||| ||||| | |||||||||||| ||||| ||||||| ||||||| | |||||||||| ||||||||||||| |
|
|
| T |
6041757 |
gctctgactttaaacgaagcccccctcaaatgggcggtgagattgttccccttagattagtcggttcttggatcagataccgagtttt |
6041670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 33398547 - 33398468
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| | |||| | |||||| ||||||||||||||||||||| |||| |
|
|
| T |
33398547 |
ctttaaacggggcccccgcaagtgggcggtgggattggttccctcgaattagtcgattcttggatcggataccgaatttt |
33398468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 33698792 - 33698705
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||| |||||||||| |||||| |||||| |||||| ||||||||| |||||||||| |
|
|
| T |
33698792 |
gctctggctttaaacggggctcccgcaaatgggtggtgggattggtcccctcaaattagtcgattctcggatcggatgccgagttttc |
33698705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 126 - 204
Target Start/End: Complemental strand, 55371381 - 55371302
Alignment:
| Q |
126 |
agctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
||||||| ||| ||||||||||| | ||| ||||||||||||||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
55371381 |
agctctggcttaaaacggggccctcgcaagtgggcggtgggattggtcccctcggattagtcgatccttggatcggatac |
55371302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 34492661 - 34492575
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| ||| | ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
34492661 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtccattcagattagttgattcttggatctgataccgagtttt |
34492575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 3747730 - 3747779
Alignment:
| Q |
164 |
ggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3747730 |
ggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
3747779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 146 - 207
Target Start/End: Original strand, 26158942 - 26159003
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccga |
207 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| |||||||| | | ||||||||||||||||| |
|
|
| T |
26158942 |
ccccgcaagtgggcggtgggattgatcccctcggattagtcggtccttggatcggataccga |
26159003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 144 - 212
Target Start/End: Original strand, 25017618 - 25017685
Alignment:
| Q |
144 |
ggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||| ||||||||||||||| | || |||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
25017618 |
ggccccgcaagtgggcggtgggattggttcc-ttggattagtcgattcttggatcgaataccgagtttt |
25017685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 129 - 212
Target Start/End: Complemental strand, 7485613 - 7485531
Alignment:
| Q |
129 |
tctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| |||||||| || ||| ||| ||| ||||||||||| |||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
7485613 |
tctggctttaaacaggcccctgcaagtggccggtgggattggtccc-tcggattagtcgattcttggatcggataccgagtttt |
7485531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 8958101 - 8958034
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| ||||| | |||||||||||| |||||||||||||| |
|
|
| T |
8958101 |
ccccgcaagtgggcggtgggattggtcccctctgattaatcgattcttggatcagataccgagttttc |
8958034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 40940936 - 40941023
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| ||| |||||| |||||| | |||| | ||||||| ||| |||||||||||||| |
|
|
| T |
40940936 |
gctctgactttaaacggggcccccacaagtgggtggtaggattggtcccctcgaattactcaattcttgaatcagataccgagttttc |
40941023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 204
Target Start/End: Complemental strand, 4252462 - 4252404
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
|||||||| ||| ||||||||||| |||||| |||||||| ||| |||||||||||||| |
|
|
| T |
4252462 |
ccccacaagtggacggtgggattggtcccctcggattagtcgatccttggatcggatac |
4252404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 1692945 - 1693030
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||| || || |||| ||| |||||||||||||| ||||| ||||||| |||||||| ||||||||||||||||| |
|
|
| T |
1692945 |
gctctggctttagacaggcccccgcaagtgggcggtgggatttgccccctcagattagtcgattcttgaatcggataccgagtttt |
1693030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 128 - 212
Target Start/End: Complemental strand, 31537923 - 31537838
Alignment:
| Q |
128 |
ctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||| |||||||||| ||||| ||| ||||||||| ||||| |||||| | |||||| |||||||||||||||| |||||||| |
|
|
| T |
31537923 |
ctctggctttaaacggagcccctgcaagtgggcggtgagattggtcccctcgaattagtcaattcttggatcggatatcgagtttt |
31537838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 213
Target Start/End: Original strand, 7195917 - 7196005
Alignment:
| Q |
126 |
agctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||| ||| |||| ||| ||||| ||||||||| |||||| ||||||| ||||||| ||| |||||||||||||| |
|
|
| T |
7195917 |
agctctgactttaaatgggccccccacatgtgggcagtgggattggtcccctcagattagtcgattctttgattagataccgagttttc |
7196005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 134 - 194
Target Start/End: Complemental strand, 29915348 - 29915288
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttg |
194 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||| | | |||||| |||||||| |
|
|
| T |
29915348 |
ctttaaacgggcccccgcaagtgggcggtgggattgatcccatcgaattagtcgattcttg |
29915288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 134 - 194
Target Start/End: Complemental strand, 29964501 - 29964441
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttg |
194 |
Q |
| |
|
||||||||||| |||| ||| |||||||||||||||||||| | | |||||| |||||||| |
|
|
| T |
29964501 |
ctttaaacgggcccccgcaagtgggcggtgggattgatcccatcgaattagtcgattcttg |
29964441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 151 - 207
Target Start/End: Complemental strand, 32414637 - 32414581
Alignment:
| Q |
151 |
caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccga |
207 |
Q |
| |
|
|||||| |||||| ||||||||||||| |||||| ||||||| ||||||||||||| |
|
|
| T |
32414637 |
caaatgagcggtgagattgatccccttaaattagtcgattcttagatcggataccga |
32414581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 181
Target Start/End: Original strand, 1242085 - 1242139
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggat |
181 |
Q |
| |
|
|||||| |||||||||||| ||| ||| |||||||||| |||| ||||||||||| |
|
|
| T |
1242085 |
gctctggctttaaacggggtcccgcaagtgggcggtggaattggtccccttggat |
1242139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 171 - 213
Target Start/End: Original strand, 11390758 - 11390800
Alignment:
| Q |
171 |
tccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
11390758 |
tcccctcggattagtcgattcttggatcggatactgagttttc |
11390800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 197
Target Start/End: Complemental strand, 14343374 - 14343304
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggat |
197 |
Q |
| |
|
|||||| |||||||||| ||||||| || ||||| | |||||||||||| ||||||| ||||||||||| |
|
|
| T |
14343374 |
gctctgcctttaaacggtatcccacaagtgagcggtagaattgatccccttagattagtcgattcttggat |
14343304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 53288791 - 53288713
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||| |||| || ||||| |||| |||||| | |||||| |||| ||||||||| |||| |||||| |
|
|
| T |
53288791 |
ctttaaacggggccccgcaaacggacggtgagattagtcccctcgaattagtcgattattggatcggttaccaagtttt |
53288713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 159 - 213
Target Start/End: Original strand, 55287929 - 55287983
Alignment:
| Q |
159 |
cggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||| |||||||| |||||| |||| |||||||||||||||| ||||| |
|
|
| T |
55287929 |
cggtgggattagtccccttgaattagtcgattattggatcggataccgaattttc |
55287983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 62; Significance: 9e-27; HSPs: 42)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 109 - 211
Target Start/End: Complemental strand, 37351558 - 37351454
Alignment:
| Q |
109 |
atacagagcttgctctg--agctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccg |
206 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||| ||||||||||||||| |||||| |||||||| | | |||||||||||||||| |
|
|
| T |
37351558 |
atacagagcttgctctggaagctctggctttaaacgggcccccacaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccg |
37351459 |
T |
 |
| Q |
207 |
agttt |
211 |
Q |
| |
|
||||| |
|
|
| T |
37351458 |
agttt |
37351454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 26513233 - 26513148
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||||||| || |||||| |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
26513233 |
gctctgactttaaacgggcccccacaagtgggcggtgggaatggtcccctcggattagtcgattcttggatcgaataccgagtttt |
26513148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 4621323 - 4621236
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4621323 |
gctctggctttaaacggggtccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
4621236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 8254838 - 8254751
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
8254838 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattgatccccttgaattagtcgattcttgaatcggataccgagttttc |
8254751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 24122134 - 24122220
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
24122134 |
gctctggctttaaacggggctcccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
24122220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 7766813 - 7766726
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
7766813 |
gctctgactttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggatatcgagttttc |
7766726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 134 - 211
Target Start/End: Original strand, 34778457 - 34778535
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34778457 |
ctttaaacggggcccccgcaagtggacggtgggattggtccccttggattagtcgattcttggatcggataccgagttt |
34778535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 7578520 - 7578607
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||| |||||||||| | |||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7578520 |
gctctgactttaaacggggccctcgcaagtgggtggtgggattggttccctcggattagttgatttttggatcggataccgagttttc |
7578607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 15059488 - 15059401
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||| |||| ||| ||||||||| ||||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
15059488 |
gctctggctttaaacggggtccccgcaagtgggcggtgagattggtcccctcgaattagtcgattcttggatcggataccgagttttc |
15059401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 32729655 - 32729742
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||| |||| ||| ||||||||||||||||||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
32729655 |
gctctggctttaaatggggtccccgcaagtgggcggtgggattgatccccttggattagtcggtctttggatcggataccgagttttc |
32729742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 24674504 - 24674590
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| | |||||| ||||||||||||||||||||| |||| |
|
|
| T |
24674504 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcgtattagtcgattcttggatcggataccgaatttt |
24674590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 17935880 - 17935965
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||| |||||||| ||| || |||||||| ||||||||||||||||||||||||| |
|
|
| T |
17935880 |
gctctggctttaaacggggcccccgcaagtgggcgatgggattggtccactcggattagtcgattcttggatcggataccgagttt |
17935965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 2272455 - 2272542
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| ||||||||||| | |||||||| |||||| |||||||||| |||||||| |
|
|
| T |
2272455 |
gctctgactttaaacggggcccctacaagggggcggtaggattgatcccatcggattagtcgattctaagatcggatactgagttttc |
2272542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 22909982 - 22910069
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||| ||||| ||| |||||||||||||| |||||| |||||||| ||| ||| ||||||||||||||||||| |
|
|
| T |
22909982 |
gctctgactttaaacggagcccccgcaagtgggcggtgggatttgtcccctcggattagtcgatacttcgatcggataccgagttttc |
22910069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 7197333 - 7197247
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||| |||||| ||| ||||||||| ||||| |||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
7197333 |
gctctggctttaaacgaggcccctgcaagtgggcggtgagattggtcccctcggattagtcgattcatggatcggataccgagtttt |
7197247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 155 - 213
Target Start/End: Complemental strand, 27454921 - 27454863
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||| |||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
27454921 |
tgggcggtgggattggtcccctcggattagtcgattcttggatcggatacctagttttc |
27454863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 48699877 - 48699957
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||||| |||| | |||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
48699877 |
ctttaaacggagcccccgcaagtgggcggtgggattgttcccttcggattagtcgattcttggatcggatatcgagttttc |
48699957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 134 - 204
Target Start/End: Complemental strand, 8779815 - 8779744
Alignment:
| Q |
134 |
ctttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||||||| |||||| |||||||| ||||||| |||||||||| |
|
|
| T |
8779815 |
ctttaaacggggcccccacaagtaggcggtgggattggtcccctcggattagtcgattcttagatcggatac |
8779744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 46607941 - 46608008
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| |||||||||||||||||||||| |||||||| | | ||||||||||||| ||||||||| |
|
|
| T |
46607941 |
ccccgcaagtgggcggtgggattgatcccctcggattagtcggtccttggatcggatatcgagttttc |
46608008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 9500441 - 9500355
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||| ||||| |||| ||||||||| ||||| || | | |||||||| ||||||||||||||||| |||||||| |
|
|
| T |
9500441 |
gctctggctttaaacggagcccccacaagtgggcggtgagattggtctcttcggattagtcgattcttggatcggatatcgagtttt |
9500355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 134 - 207
Target Start/End: Original strand, 21726847 - 21726921
Alignment:
| Q |
134 |
ctttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccga |
207 |
Q |
| |
|
||||||||||| |||| |||| ||||||||||| |||||||||| ||||| | ||||||||||||||||||||| |
|
|
| T |
21726847 |
ctttaaacgggtcccccacaagtgggcggtggggttgatcccctcagattaatcgattcttggatcggataccga |
21726921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 35138119 - 35138185
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||||||||||||||||| |||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
35138119 |
ccccgcaagtgggcggtgggattgattccctcggattagtcggtccttggatcggataccgagtttt |
35138185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 208
Target Start/End: Original strand, 1379009 - 1379090
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgag |
208 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||| ||||| ||||| |||||| ||||||| ||||||| |||||||||||||| |
|
|
| T |
1379009 |
gctctggctttaaacgggcccccgcaagtggacggtgagattggtcccctcagattagtcgattcttagatcggataccgag |
1379090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 40802154 - 40802069
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||| |||| |||| ||||| ||| || | |||||| |||||||| |||| |||||||||||| |
|
|
| T |
40802154 |
gctctgactttaaacgggtccccgcaagtgggtggtgagattggtcctctagaattagtcgattcttgaatcgaataccgagtttt |
40802069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 166 - 213
Target Start/End: Original strand, 14603947 - 14603994
Alignment:
| Q |
166 |
attgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
14603947 |
attggtcccctcggattagtcgattcttggatcggataccgagttttc |
14603994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 161 - 212
Target Start/End: Original strand, 23041668 - 23041719
Alignment:
| Q |
161 |
gtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||| |||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
23041668 |
gtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
23041719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 5315478 - 5315528
Alignment:
| Q |
162 |
tgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| |||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
5315478 |
tgggattggtcccctcggataagtcgattcttggatcggataccgagtttt |
5315528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 9926212 - 9926146
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| |||||||||||||||||||| || ||||||| | | ||| |||||||||||||||||| |
|
|
| T |
9926212 |
ccccgcaactgggcggtgggattgatccctttagattagtcggtccttcgatcggataccgagtttt |
9926146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 135 - 213
Target Start/End: Original strand, 27159205 - 27159283
Alignment:
| Q |
135 |
tttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||| |||| ||| ||| ||||||||||| |||||| ||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
27159205 |
tttaaacgggcccccgcaagtggacggtgggattggtcccctcagattagtcgatctttggatcggatatcgagttttc |
27159283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 128 - 202
Target Start/End: Complemental strand, 43770049 - 43769975
Alignment:
| Q |
128 |
ctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggat |
202 |
Q |
| |
|
||||||| || || ||| |||||||||||||||||||||||| |||| | | |||||| |||||| ||||||||| |
|
|
| T |
43770049 |
ctctgaccttgaatgggaccccacaaatgggcggtgggattggtcccttcgaattagtcgattctaggatcggat |
43769975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 207
Target Start/End: Original strand, 18646964 - 18647045
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaa-tgggcggtgggattgatccccttggattagtagattcttggatcggataccga |
207 |
Q |
| |
|
|||||| |||||||||| ||||| || ||||||||| |||||||||||| | |||||| |||||||| |||||||||||| |
|
|
| T |
18646964 |
gctctggctttaaacggagcccctgtaagtgggcggtgagattgatcccctcgaattagtcgattcttgaatcggataccga |
18647045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 36155945 - 36155888
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| |||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
36155945 |
tgggcggtgggattggtcccttcaaattagtcgattcttggatcggataccgagtttt |
36155888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 45331701 - 45331621
Alignment:
| Q |
134 |
ctttaaacggggc--cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||| ||| ||| ||| |||||||||| ||||||| ||||| | |||||||| ||||||||||||||||| |
|
|
| T |
45331701 |
ctttaaacggggctccccgcaagtggacggtgggattaatcccctcagattaatcgattcttgaatcggataccgagtttt |
45331621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 129 - 212
Target Start/End: Complemental strand, 18533808 - 18533724
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||||||||| |||||| |||| | ||||||| ||||||||||| |||||| |
|
|
| T |
18533808 |
tctgactttaaacggggcccctgcaagtgggccgtgggattggtcccctcatattaatcgattcttagatcggataccaagtttt |
18533724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 30677307 - 30677374
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| ||||||| | |||||||| |||||| ||||||||| |
|
|
| T |
30677307 |
ccccgcaagtgggcggtgggattggtcccctcagattagtcggttcttggaccggatatcgagttttc |
30677374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 134 - 212
Target Start/End: Complemental strand, 45859122 - 45859043
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| ||||||| ||| |||| ||| |||||| |||||| |||||||| |||| |||||||||||||||| |||| |
|
|
| T |
45859122 |
ctttaaacagggcccccgcaagtgggtggtaggattggtcccctcggattagttgattattggatcggataccgaatttt |
45859043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 23734234 - 23734315
Alignment:
| Q |
134 |
ctttaaacgggg--ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| |||||| ||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
23734234 |
ctttaaacggggccccccgcaagtgggcggtgaaattggtcccctcagattagtcgattcttgaatcggataccaagttttc |
23734315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 23741426 - 23741507
Alignment:
| Q |
134 |
ctttaaacgggg--ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||| |||| ||| ||||||||| |||| |||||| ||||||| |||||||| |||||||||| ||||||| |
|
|
| T |
23741426 |
ctttaaacggggccccccgcaagtgggcggtgaaattggtcccctcagattagtcgattcttgaatcggataccaagttttc |
23741507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 151 - 212
Target Start/End: Original strand, 809358 - 809419
Alignment:
| Q |
151 |
caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||||| | || | ||| |||| ||||||||||| |||||| ||||||| |
|
|
| T |
809358 |
caaatgggcggtgggattggttccttcggagtagtcgattcttggattggatactgagtttt |
809419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 33905594 - 33905509
Alignment:
| Q |
129 |
tctgactttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||||||||||| || || ||| |||||||||||||||||| ||| | ||||||| ||||||||||||||||||| |
|
|
| T |
33905594 |
tctggctttaaacggggcctccgtaagtggacggtgggattgatcccctcaaatttatcgattctttgatcggataccgagttttc |
33905509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 210
Target Start/End: Original strand, 8077758 - 8077841
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtt |
210 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||||||||||||||| ||||| | ||||| | |||| |||||||||| |||||||| |
|
|
| T |
8077758 |
gctctggctttaaacagggcccccgcaagtgggcggtgggattggtcccc-tcgattaatcgattattggatcggagaccgagtt |
8077841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 204
Target Start/End: Complemental strand, 40145945 - 40145889
Alignment:
| Q |
148 |
ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
|||||| |||| |||| | ||| |||||| |||||||| |||||||||||||||||| |
|
|
| T |
40145945 |
ccacaagtgggtggtgagtttggtcccctcggattagtcgattcttggatcggatac |
40145889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0576 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0576
Description:
Target: scaffold0576; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 5168 - 5081
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5168 |
gctctggctttaaacggggcccccgcaaatgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
5081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 44)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 2751386 - 2751473
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2751386 |
gctctggctttaaacggggcccccgcaaatgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
2751473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 3851872 - 3851958
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
3851872 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagtttt |
3851958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 134 - 213
Target Start/End: Complemental strand, 21217912 - 21217832
Alignment:
| Q |
134 |
ctttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||| |||| |||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
21217912 |
ctttaaacgggccccccacaagtgggcggtgggattgatcccctcggattagttgattcttggatcggataccgagttttc |
21217832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 22120003 - 22120090
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22120003 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
22120090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 40542996 - 40542909
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40542996 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
40542909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 654790 - 654704
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
654790 |
gctctggctttaaacgggcccccgcaagtgggcggtgggattggtcccctcggattagtcggttcttggatcggataccgagttttc |
654704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 21835266 - 21835353
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
21835266 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatatcgagttttc |
21835353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 23092211 - 23092298
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||||| ||||||||||| |||||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
23092211 |
gctctggctttaaacggggcccccgcaaatggacggtgggattggtcccctcggattagtcgattcatggatcggataccgagttttc |
23092298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 29861785 - 29861872
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||||||||| | |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
29861785 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattgatcccctcgaattagtcgattcttagatcggataccgagttttc |
29861872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 7275392 - 7275478
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
7275392 |
gctctggctttaaacagggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
7275478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 17197036 - 17196950
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
17197036 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
17196950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 128 - 213
Target Start/End: Original strand, 27312268 - 27312354
Alignment:
| Q |
128 |
ctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27312268 |
ctctgactttaaacggagcccccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagttttc |
27312354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 22638403 - 22638488
Alignment:
| Q |
127 |
gctctgactttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||||||||| || ||| |||||||||||||||||| ||| | |||||| ||||||||||||||||||||||||| |
|
|
| T |
22638403 |
gctctggctttaaacggggcctccgcaagtgggcggtgggattgatctcctcgaattagtcgattcttggatcggataccgagttt |
22638488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 16374116 - 16374196
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16374116 |
ctttaaacgggacccccgcaaatggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
16374196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 11997964 - 11998051
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||||||||||||||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
11997964 |
gctctggctttaaactgggcccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttttc |
11998051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 42913599 - 42913512
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||| ||||||||||| |||||| |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
42913599 |
gctctggctttaaacggggcccccgcaagtggacggtgggattggtcccctcggattagttgattcttagatcggataccgagttttc |
42913512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 18044222 - 18044308
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| |||| |||| ||||| |||| |||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
18044222 |
gctctggctttaaacggggcccccacaagtgggtggtggaattggtcccctcagattagtcgattcttggatcggataccgagtttt |
18044308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 28089935 - 28090021
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| ||| |||| ||| |||||| || ||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28089935 |
gctctggctttaaatgggcccccgcaagtgggcgatgagattggtcccctcggattagtcgattcttggatcggataccgagttttc |
28090021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 19421346 - 19421431
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||||||| || ||| |||||||| |||||||| ||| |||||||||||| |
|
|
| T |
19421346 |
gctctgactttaaatggggcgcccacaagtgggcggtgggattggtctcctcggattagtcgattcttgaatcagataccgagttt |
19421431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 31712959 - 31712902
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
31712959 |
tgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
31712902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 7175928 - 7175861
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
7175928 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatactgagttttc |
7175861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 10091303 - 10091389
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||| |||| ||| |||||||||||||||||||||| |||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
10091303 |
gctctggctttaaatggggtccccgcaagtgggcggtgggattgatcccctcggattagtcgattctt-gatccgataccgagttttc |
10091389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 22703601 - 22703688
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| |||||||| ||||||| ||||||||||| ||||||| |
|
|
| T |
22703601 |
gctctggctttaaacgggacccccgcaagtgggcggtgggattggtcccctcggattagtcgattctttgatcggatacccagttttc |
22703688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 31274029 - 31274115
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||| || ||| ||||| ||| ||||| |||||| | |||||| |||||||||| |||||||||||||||| |
|
|
| T |
31274029 |
gctctggctttaaacggggctccgcaagtgggcagtgagattggtcccctcgaattagtcgattcttggaccggataccgagttttc |
31274115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 31197712 - 31197792
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||| ||| ||| ||||||||||| |||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
31197712 |
ctttaaacggggcccccgcaagtggtcggtgggattggtcccctcagattagtcgattcttggatcggatatcgagttttc |
31197792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 23012594 - 23012507
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| |||| ||||||||||||||| |||||| | |||||| |||| | ||||||||||||||||||| |
|
|
| T |
23012594 |
gctctggctttaaatggggcccccacaagtgggcggtgggattggtcccctcgtattagtcaattcattgatcggataccgagttttc |
23012507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 27009474 - 27009561
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaa-tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| ||||||||||| |||||| |||||| ||||||||||| |||||||||||||| |
|
|
| T |
27009474 |
gctctgactttaaacggggcccctgcaaagtggacggtgggattggtcccctcaaattagtcgattcttggattggataccgagtttt |
27009561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 213
Target Start/End: Complemental strand, 43785377 - 43785298
Alignment:
| Q |
135 |
tttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||| || ||| ||| ||||| ||||| ||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
43785377 |
tttaaacggggcctccgcaagtggacggtgagattggtccccttggattagtcgatttttggatcggataccgagctttc |
43785298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 128 - 212
Target Start/End: Original strand, 25333519 - 25333603
Alignment:
| Q |
128 |
ctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||| || |||| ||| ||||| ||||||||| |||||| |||||||| ||||||||||||||| |||||||||| |
|
|
| T |
25333519 |
ctctgactttaaacaggccccccgcaagtgggcagtgggattggtcccctcggattagtcgattcttggatcgga-accgagtttt |
25333603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 32849706 - 32849791
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| ||||||| ||| | |||| || ||||| ||||||||| |||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
32849706 |
gctctggctttaaatgggactcccataagtgggcagtgggattggtcccctcagattagtcgattcttggatcggataccgagttt |
32849791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 139 - 207
Target Start/End: Complemental strand, 1766217 - 1766149
Alignment:
| Q |
139 |
aacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccga |
207 |
Q |
| |
|
||||||||||||||| |||||||| |||||| |||||| |||||||| | | |||| |||||||||||| |
|
|
| T |
1766217 |
aacggggccccacaagtgggcggttggattggtcccctcggattagtcggtacttgaatcggataccga |
1766149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 2344421 - 2344501
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||| |||| ||| || |||||||||||| |||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
2344421 |
ctttaaacgggacccccgcaagtgagcggtgggattggtcccctcggattagtcggtccttggatcggataccgagttttc |
2344501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 128 - 211
Target Start/End: Original strand, 9683942 - 9684026
Alignment:
| Q |
128 |
ctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||| |||| | |||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
9683942 |
ctctggctttaaacggggtccccacaagtgggcggtaggataggtcccctcggattaatcgattcttggatcgattaccgagttt |
9684026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 146 - 213
Target Start/End: Complemental strand, 21574168 - 21574101
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||| | ||||||| ||||| |||||| |||||||| | | ||||||||||||||||||||||| |
|
|
| T |
21574168 |
ccccacaagtaggcggtgagattggtcccctcggattagtcggtccttggatcggataccgagttttc |
21574101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 146 - 204
Target Start/End: Complemental strand, 8943467 - 8943409
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggatac |
204 |
Q |
| |
|
|||| ||| ||||||||| ||||| |||||||| |||||| |||||||||||||||||| |
|
|
| T |
8943467 |
ccccgcaagtgggcggtgtgattggtccccttgaattagtcgattcttggatcggatac |
8943409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 41907599 - 41907514
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||| |||||| ||| |||| |||||||||| ||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
41907599 |
gctctggctttaaacgtggcccccgcaagtgggtggtgggattggtcccccag-attagtcgattcttggatcggataccgagtttt |
41907514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 39145737 - 39145652
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| ||| ||| ||| ||||||||||| |||||| | |||||| |||||||| ||| |||||| |||||| |
|
|
| T |
39145737 |
gctctggctttaaacgggcccctgcaagtggacggtgggattggtcccctcgaattagtcgattcttgaatcagataccaagtttt |
39145652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 2103170 - 2103255
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||||||||||||||| |||| | |||||||| ||||| || |||||||||||||||||| |
|
|
| T |
2103170 |
gctctggctttaaatggggcccccgcaagtgggcggtgggattggtccc-tcggattagtcgattcatg-atcggataccgagttttc |
2103255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 9718073 - 9717986
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||| |||| || ||| | |||||| | |||||| |||| |||| |||||||| |
|
|
| T |
9718073 |
gctctggctttaaacggggccctcacaaatgagcggtggaattggtctcctcgaattagtcggttcttgaatcgaatactgagttttc |
9717986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 27704136 - 27704202
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| |||| |||| |||||||||||| ||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
27704136 |
ccccgcaagtgggtggtgtgattgatcccctcagattagtcgattcttgaatcagataccgagtttt |
27704202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 28950986 - 28951072
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| ||| | ||| | ||||||||||||| |||||| | | ||| ||||||||||||||||||||||||| |
|
|
| T |
28950986 |
gctctggctttaaacgggtccctcgcaagtcggcggtgggattggtcccctcgaactagacaattcttggatcggataccgagtttt |
28951072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 36772389 - 36772303
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaa-tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||||| ||| ||| || |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
36772389 |
gctctggctttaaacggggcccccgggagtgggcggtggaattagtcctctcggattagtcgattctttgatcggataccgagtttt |
36772303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 205
Target Start/End: Original strand, 17212202 - 17212247
Alignment:
| Q |
160 |
ggtgggattgatccccttggattagtagattcttggatcggatacc |
205 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||| |||||| |
|
|
| T |
17212202 |
ggtgggattggtcccctcggattagtcgattcttggatcagatacc |
17212247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 157 - 210
Target Start/End: Complemental strand, 30345564 - 30345511
Alignment:
| Q |
157 |
ggcggtgggattgatccccttggattagtagattcttggatcggataccgagtt |
210 |
Q |
| |
|
||||||||||||| |||||| || ||||| | ||||| |||||||||||||||| |
|
|
| T |
30345564 |
ggcggtgggattggtcccctcgggttagtcggttcttagatcggataccgagtt |
30345511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 41)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 264485 - 264400
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |||||||||||| | |||||| ||||||||||||||||||||| |||| |
|
|
| T |
264485 |
gctctggctttaaacgggcccccacaaatgggcggtgagattgatcccctcgaattagtcgattcttggatcggataccgaatttt |
264400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 651436 - 651521
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |||||||||||| | |||||| ||||||||||||||||||||| |||| |
|
|
| T |
651436 |
gctctggctttaaacgggcccccacaaatgggcggtgagattgatcccctcgaattagtcgattcttggatcggataccgaatttt |
651521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 837171 - 837256
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |||||||||||| | |||||| ||||||||||||||||||||| |||| |
|
|
| T |
837171 |
gctctggctttaaacgggcccccacaaatgggcggtgagattgatcccctcgaattagtcgattcttggatcggataccgaatttt |
837256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 28193589 - 28193674
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
28193589 |
gctctggctttaaacggggcccctacaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
28193674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 2639497 - 2639410
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2639497 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
2639410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 3734709 - 3734622
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||| ||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3734709 |
gctctggctttaaacggggcccccgcaaatgggcagtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
3734622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 4718760 - 4718847
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4718760 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
4718847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 8765612 - 8765525
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||| ||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8765612 |
gctctggctttaaacggggctcccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
8765525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 32879394 - 32879481
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||||||||||||| |||||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32879394 |
gctctgacattaaacggggcccccacaagtgggcggtgggattggtcccctcggattagtcgattcttggattggataccgagttttc |
32879481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 39349371 - 39349458
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||||||||||||||||||||| |||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
39349371 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccaagttttc |
39349458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 21603345 - 21603431
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
21603345 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
21603431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 34237741 - 34237654
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| || |||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34237741 |
gctctggctttaaacggggcccccgcaagtgagcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
34237654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 10292169 - 10292255
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||||| |||| | |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
10292169 |
gctctggctttaaacggggcccccacaagtgggcggtgggattggtcccttcggattagttgattcttggatcgaataccgagtttt |
10292255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 148 - 213
Target Start/End: Original strand, 14633091 - 14633156
Alignment:
| Q |
148 |
ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
14633091 |
ccacaagtgggcggtgggattggtccccttggattagtcgattcttggatcggataccaagttttc |
14633156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 2618301 - 2618388
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||| ||||| ||| ||||||||||||||| |||||| |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
2618301 |
gctctggctttaaacggagcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggattccgagttttc |
2618388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 42328119 - 42328206
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||| || |||||||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
42328119 |
gctctggctttaaacggggcccccacaagtggacgatgggattggtcccctcgaattagtcgattcttggatcggataccgagttttc |
42328206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 142 - 212
Target Start/End: Complemental strand, 42643188 - 42643118
Alignment:
| Q |
142 |
ggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| ||| ||||||||||||||| |||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
42643188 |
ggggccccgcaagtgggcggtgggattggtcccctcgcattagttgattcttggatcggataccgagtttt |
42643118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 20306023 - 20306110
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| | |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
20306023 |
gctctggctttaaacgggacccccgcaagtgggcggtgggattggtcccctcgaattagtcgatccttggatcggataccgagttttc |
20306110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 21092656 - 21092743
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||||||| |||||| | |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
21092656 |
gctctggctttaaacgggacccccgcaagtgggcggtgggattggtcccctcgaattagtcgatccttggatcggataccgagttttc |
21092743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 19471724 - 19471812
Alignment:
| Q |
127 |
gctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| | || |||||| |||||||| |||||| | |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19471724 |
gctctggctttaaacggggccccccgcaagtgggcgatgggattggtcccctcgaattagtcgatacttggatcggataccgagttttc |
19471812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 19542648 - 19542736
Alignment:
| Q |
127 |
gctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| | || |||||| |||||||| |||||| | |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19542648 |
gctctggctttaaacggggccccccgcaagtgggcgatgggattggtcccctcgaattagtcgatacttggatcggataccgagttttc |
19542736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 19590048 - 19589960
Alignment:
| Q |
127 |
gctctgactttaaacggggccccac--aaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| | || |||||| |||||||| |||||| | |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
19590048 |
gctctggctttaaacggggccccccgcaagtgggcgatgggattggtcccctcgaattagtcgatacttggatcggataccgagttttc |
19589960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 25248463 - 25248547
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||||||| || | ||| ||||||||||||||| |||||| |||||||| |||| || |||||||||||||||||| |
|
|
| T |
25248463 |
gctctggctttaaacgggccctcgcaagtgggcggtgggattggtcccctcggattagtcgatt-tttgatcggataccgagtttt |
25248547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 127 - 203
Target Start/End: Original strand, 28088401 - 28088478
Alignment:
| Q |
127 |
gctctgactttaaacggggcc-ccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggata |
203 |
Q |
| |
|
|||||||||||||| |||||| || ||| |||||||||||||||||||||| || |||| ||||||||||||||||| |
|
|
| T |
28088401 |
gctctgactttaaatggggcctccgcaagtgggcggtgggattgatcccctcagaatagtcgattcttggatcggata |
28088478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 4698809 - 4698722
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||| ||||| ||| || |||||||||||| |||||| |||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
4698809 |
gctctggctttaaacggagcccccgcaagtgagcggtgggattggtcccctcggattagtcgattcatggattggataccgagttttc |
4698722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 12312968 - 12313046
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||| | |||||| | ||||| || |||| |||||||||| |
|
|
| T |
12312968 |
ctttaaatgggcccccacaagtgggcggtgggattgatcccctcgaattagtcggttcttagagcggaaaccgagtttt |
12313046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 18128628 - 18128714
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| ||| || ||||||| | ||||||||||| |||||||||||| |
|
|
| T |
18128628 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcctctcagattagtcggttcttggatcgaataccgagtttt |
18128714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 211
Target Start/End: Complemental strand, 15259492 - 15259407
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||| |||| |||||| | |||||| |||||||||||||||| |||||||| |
|
|
| T |
15259492 |
gctctggctttaaacggggcccccgcaagtgggcggtgtaattggtcccctcgaattagtcgattcttggatcggatgccgagttt |
15259407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 34610773 - 34610686
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||| | ||| | ||| |||||||| | |||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
34610773 |
gctctggctttaaacgagcccctcgcaagtgggcggtagaattggtcccctcgaattagtcgattcttggatcggataccgagttttc |
34610686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 6953093 - 6953008
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||| ||||||| ||| | ||||||||||||| |||| | |||||||| ||||||||||||| |||||||||||| |
|
|
| T |
6953093 |
gctctggctttaaacagggcccccgcaagttggcggtgggattggtccc-tcggattagtcgattcttggatcgaataccgagtttt |
6953008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 129 - 211
Target Start/End: Complemental strand, 7558034 - 7557952
Alignment:
| Q |
129 |
tctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||| |||||||||| |||| ||| ||| ||||||||||| |||||| | |||||| |||| ||| |||||||||||||||| |
|
|
| T |
7558034 |
tctggctttaaacggacccccgcaagtggacggtgggattggtcccctcgaattagtcgatttttgcatcggataccgagttt |
7557952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Original strand, 16990727 - 16990785
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||| || ||||||||||||||| | | ||||||||||||||| ||||||| |
|
|
| T |
16990727 |
tgggcggtgggactggtccccttggattagtcggtccttggatcggataccaagttttc |
16990785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 176 - 213
Target Start/End: Original strand, 18532263 - 18532300
Alignment:
| Q |
176 |
ttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18532263 |
ttggattagtcgattcttggatcggataccgagttttc |
18532300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 27746421 - 27746334
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatggg-cggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||| |||| || ||| ||| |||||| |||||||| ||||||||||||| ||| ||| ||||| |
|
|
| T |
27746421 |
gctctggctttaaaaggggccccacaagtggggcgatggaattagtcccctcggattagtcgattcttggatcgaatatcgatttttc |
27746334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 2166831 - 2166897
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| ||||||| |||| || ||| |||||||||||||| |
|
|
| T |
2166831 |
ccccgcaagtgggcggtgggattggtcccctcagattagtcgattttttgattggataccgagtttt |
2166897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 178 - 212
Target Start/End: Original strand, 9713621 - 9713655
Alignment:
| Q |
178 |
ggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
9713621 |
ggattagtcgattcttggatcggataccgagtttt |
9713655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 20470052 - 20470117
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||||||||||||||| | || | |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
20470052 |
ccccgcaagtgggcggtgggattggttcc-tcggattagtcgatttttggatcggataccgagtttt |
20470117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 1219466 - 1219551
Alignment:
| Q |
129 |
tctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||||||||| ||||| || |||||||| |||| | |||| | |||||||| ||||||| ||||| ||||||| ||||| |
|
|
| T |
1219466 |
tctggctttaaacggggcccccataagtgggcggtaggatcggtcccttcggattagtcgattcttagatcgaataccgaattttc |
1219551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 28964150 - 28964234
Alignment:
| Q |
129 |
tctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||||||||| |||| ||| ||||| ||||||||| |||||| | |||||| ||||||| ||||| |||| |||||||| |
|
|
| T |
28964150 |
tctggctttaaacggggcccccgcaagtgggc-gtgggattggtcccctcgaattagtcgattcttagatcgaatactgagttttc |
28964234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 211
Target Start/End: Complemental strand, 8387512 - 8387460
Alignment:
| Q |
159 |
cggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||| ||| |||||||||| |||||| |
|
|
| T |
8387512 |
cggtgggattgatctcctcggattagttgatccttagatcggatactgagttt |
8387460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 213
Target Start/End: Complemental strand, 10544956 - 10544924
Alignment:
| Q |
181 |
ttagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
10544956 |
ttagtcgattcttggatcggataccgagttttc |
10544924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 56; Significance: 3e-23; HSPs: 49)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 19660618 - 19660531
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| ||||||| ||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19660618 |
gctctggctttaaacagggcccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagttttc |
19660531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 34844844 - 34844757
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34844844 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
34844757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 40058938 - 40058851
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40058938 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttttc |
40058851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 127 - 211
Target Start/End: Original strand, 52983730 - 52983815
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
52983730 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
52983815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 5609288 - 5609201
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||| |||||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
5609288 |
gctctggctttaaatggggcccccgcaagtggacggtgggattgatcccctcggattagtcgattcttggatcggataccgagttttc |
5609201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 32986308 - 32986395
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||| |||||| ||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
32986308 |
gctctgactttaaatggggcccccgcaagtgggcggtgggattggtcccctcggaatagtcgattcttggatcggataccgagttttc |
32986395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 44343625 - 44343712
Alignment:
| Q |
127 |
gctctgactttaaacggggc-cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||||||||||| |||||| | |||||| |||||||| |||||||||||||||||| |
|
|
| T |
44343625 |
gctctgactttaaacggggctcccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttgaatcggataccgagttttc |
44343712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 27528881 - 27528794
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||| |||||||||| ||| ||||||||| ||||| |||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27528881 |
gctctggctttatacggggcccccgcaagtgggcggtgagattggtcccctcggattagtcgattcttggatcggataccgagttttc |
27528794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 18875602 - 18875516
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||||||| |||| |||||||||||||||| |||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
18875602 |
gctctggctttaaacgggcccccacaagtgggtagtgggattgatcccctcggattagtcaatttttggatcagataccgagttttc |
18875516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 34723910 - 34723996
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| |||| |||||||||| ||| || |||||||| |||||||||||||||||||||||||| |
|
|
| T |
34723910 |
gctctggctttaaacggggcccccgcaagtgggtggtgggattggtcctctcggattagtcgattcttggatcggataccgagtttt |
34723996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 55961839 - 55961753
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| | || | |||||| | |||||||| |||| ||||||| ||||| |
|
|
| T |
55961839 |
gctctgactttaaacggggccccacaagtgggcggtgggattggttccttcggattaatcgattcttgaatcgaataccgaattttc |
55961753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 35229278 - 35229365
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc--acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||||| |||| |||| || |||||||||||| |||||| | |||||| ||||||||||||||||||||| |||| |
|
|
| T |
35229278 |
gctctgactttaaacgggtccccccacaagtgagcggtgggattggtcccctcgaattagtcgattcttggatcggataccgaatttt |
35229365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 213
Target Start/End: Original strand, 46714511 - 46714591
Alignment:
| Q |
134 |
ctttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
46714511 |
ctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcaattcttgaatcggataccgagttttc |
46714591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 32990546 - 32990633
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| ||| |||| ||||||||||||| |||| |||||||| |
|
|
| T |
32990546 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggactagtcgattcttggatcgaatactgagttttc |
32990633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 45787790 - 45787703
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||| ||||||| ||| ||| ||||||||||| |||||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
45787790 |
gctctggctttaaacagggcccccgcaagtggacggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttttc |
45787703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 54127428 - 54127341
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| | |||||||| ||||||| |||||||| |
|
|
| T |
54127428 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcggttcttggaccggatactgagttttc |
54127341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 22488112 - 22488027
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||||||||||||||| |||||| | | ||||||||||||||| ||||||| |
|
|
| T |
22488112 |
tctggctttaaacggggcccccgcaaatgggcggtgggattgatcccctcaaattagtcggtccttggatcggataccaagttttc |
22488027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 23639768 - 23639821
Alignment:
| Q |
159 |
cggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
23639768 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23639821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 159 - 212
Target Start/End: Original strand, 23645426 - 23645479
Alignment:
| Q |
159 |
cggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| |||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
23645426 |
cggtgggattggtcccctcggattagtcgattcttggatcggataccgagtttt |
23645479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 126 - 212
Target Start/End: Original strand, 51535730 - 51535818
Alignment:
| Q |
126 |
agctctgactttaaacggggcccca--caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| |||||||||||||||| ||| ||||||||||||||| |||||| | |||||| ||||||| ||||||||||||| |||| |
|
|
| T |
51535730 |
agctctggctttaaacggggcccccagcaagtgggcggtgggattggtcccctcgaattagtcgattcttagatcggataccgaatttt |
51535818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 155 - 212
Target Start/End: Original strand, 52494628 - 52494685
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| |||||| | |||||| |||||||||||||||||||||||||| |
|
|
| T |
52494628 |
tgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagtttt |
52494685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 127 - 210
Target Start/End: Complemental strand, 20078070 - 20077986
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaa-tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtt |
210 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||||||||| | |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
20078070 |
gctctggctttaaacggggcccccgtaagtgggcggtgggattagttccctcggattagtcgattcttggatcggataccgagtt |
20077986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 146 - 212
Target Start/End: Original strand, 4064991 - 4065057
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| ||||||||||||||| |||||| |||||||| |||| |||||||||||| ||| |||| |
|
|
| T |
4064991 |
ccccacaagtgggcggtgggattggtcccctcggattagtcgatttttggatcggatatcgaatttt |
4065057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 146 - 212
Target Start/End: Complemental strand, 9978575 - 9978509
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||||||||||||||| |||| | |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
9978575 |
ccccgcaagtgggcggtgggattggtcccatcggattagttgattcttagatcggataccgagtttt |
9978509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 20566461 - 20566547
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||| ||||| ||| |||||| |||||||| |||||| ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
20566461 |
gctctggctttaaacggagcccccgcaagtgggcgctgggattggtcccctcagattagtcgattcttggatcggatatcgagtttt |
20566547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 51595133 - 51595219
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||| |||||| ||||||| | | |||||| | |||||||||||||||||||||||||| |
|
|
| T |
51595133 |
gctctgactttaaacgggatccccgcaagtggacggtggaattgatctcttcggattaatcgattcttggatcggataccgagtttt |
51595219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 203
Target Start/End: Complemental strand, 9517727 - 9517650
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggata |
203 |
Q |
| |
|
||||||||||||||||||||||| || |||| |||| ||||| |||||| |||||||| ||||||||||||||||| |
|
|
| T |
9517727 |
gctctgactttaaacggggcccccgcaggtgggtggtgagattggtcccctcggattagtcgattcttggatcggata |
9517650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 128 - 211
Target Start/End: Original strand, 13550320 - 13550404
Alignment:
| Q |
128 |
ctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
||||| |||||||||||| |||||||| |||||||| |||| | |||||| |||||| | ||||||||||||| |||||||||| |
|
|
| T |
13550320 |
ctctggctttaaacggggtccccacaagtgggcggtaggataggtcccctcggattaatcgattcttggatcgattaccgagttt |
13550404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 149 - 213
Target Start/End: Complemental strand, 23131499 - 23131435
Alignment:
| Q |
149 |
cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||| |||||||| |||||| |||||| | |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
23131499 |
cacaagtgggcggtaggattggtcccctcgaattagtcgattcttcgatcggataccgagttttc |
23131435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 4912037 - 4912124
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||| ||||| ||| |||| |||| ||||||||||| | |||||| |||||||||||| |||||||||||||| |
|
|
| T |
4912037 |
gctctggctttaaacggagcccccgcaagtgggtggtgtgattgatccccccgaattagtcgattcttggatcagataccgagttttc |
4912124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 131 - 213
Target Start/End: Complemental strand, 36131592 - 36131509
Alignment:
| Q |
131 |
tgactttaaacggggccccacaaa-tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||| |||||| |||||||| |||| || |||| |||||||||||||| |
|
|
| T |
36131592 |
tgactttaaacgggacccccgtaagtgggcggtgggattggtcccctcggattagtcgattattagatcagataccgagttttc |
36131509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Complemental strand, 7392022 - 7391964
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||| |||||| |||||||| | ||||| ||| ||||||||||||||| |
|
|
| T |
7392022 |
tgggcggtgggattgttcccctcggattagtcggttcttcgattggataccgagttttc |
7391964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 33696365 - 33696279
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||||||||| ||||| ||| || |||||||| |||||||||||||||| |||||||| |
|
|
| T |
33696365 |
gctctggctttaaatggggcccccgcaagtgggcggtgagattggtcctctcggattagtcaattcttggatcggatatcgagtttt |
33696279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 155 - 213
Target Start/End: Complemental strand, 43719144 - 43719086
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
||||||||||||||| || || |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
43719144 |
tgggcggtgggattggtcatctcggattagtcgattcttggatcggataccgaattttc |
43719086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 134 - 212
Target Start/End: Original strand, 49287976 - 49288054
Alignment:
| Q |
134 |
ctttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| ||| ||| |||||| || ||||| |||||| |||||||| |||||||||||| ||||| ||||||| |
|
|
| T |
49287976 |
ctttaaacgggctcccgcaagtgggcgctgagattggtcccctcggattagtcgattcttggatcagatactgagtttt |
49288054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 147 - 212
Target Start/End: Original strand, 37302619 - 37302684
Alignment:
| Q |
147 |
cccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||| |||||| |||||||| |||| | |||||||| |||||||| |||||||||||| |||| |
|
|
| T |
37302619 |
cccacaagtgggcgatgggattggtcccttcggattagtcgattcttgaatcggataccgaatttt |
37302684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 21387571 - 21387486
Alignment:
| Q |
127 |
gctctgactttaaacgggg-ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||| |||| ||| ||||||||||| || |||||| |||||||| |||| |||||||||||||| ||||||| |
|
|
| T |
21387571 |
gctctggctttaaacgggatccccgcaagtgggcggtggg--tggtcccctcggattagtcgattattggatcggataccaagttttc |
21387486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 13584340 - 13584253
Alignment:
| Q |
127 |
gctctgactttaaacggggccc-cacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||||||||||| |||||||| ||||||| |||| || ||| | |||||| | |||||| |||| |||| |||||||| |
|
|
| T |
13584340 |
gctctggctttaaacggggccctcacaaatgagcggtggaattggtctcctcgaattagtcggttcttgaatcgaatactgagttttc |
13584253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 27574429 - 27574516
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||||||||| | ||| |||||| |||||| | ||||||||||||||||| |||||||| |
|
|
| T |
27574429 |
gctctggctttaaaaggggcccccgcaagtgggcggtgagtttggtcccctcggattaatcaattcttggatcggatactgagttttc |
27574516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 53787143 - 53787056
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||||||||| |||||| ||||||| | || |||||||| |||||| |||||| |
|
|
| T |
53787143 |
gctctggctttaaacggagcccccgcaaatgggcggtgggattagtcccctcagattagtcggtttttggatcgaataccgggttttc |
53787056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 162 - 212
Target Start/End: Original strand, 25852362 - 25852412
Alignment:
| Q |
162 |
tgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||| |||||| |||||||| | |||||||| ||||||||||||||| |
|
|
| T |
25852362 |
tgggattggtcccctcggattagtcggttcttggaccggataccgagtttt |
25852412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 150 - 212
Target Start/End: Original strand, 33289189 - 33289251
Alignment:
| Q |
150 |
acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||| ||| ||||| |||| |||||| |||||||| |||||||||||||||||||| ||||| |
|
|
| T |
33289189 |
acaagtggacggtgagattagtcccctcggattagtcgattcttggatcggataccgggtttt |
33289251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 211
Target Start/End: Complemental strand, 41621669 - 41621583
Alignment:
| Q |
126 |
agctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
||||||||||||||| |||| ||| |||| |||| ||||||| | ||||||| ||||||| | | ||||||||||||| ||||||| |
|
|
| T |
41621669 |
agctctgactttaaatggggtccctacaagtgggtggtgggactaatcccctcagattagtcggtccttggatcggataacgagttt |
41621583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 17637908 - 17637852
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||| |||| |||||| |||||||| |||||||| ||||||||||||||||| |
|
|
| T |
17637908 |
tgggcggtgatattggtcccctcggattagtcgattcttg-atcggataccgagtttt |
17637852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 6427102 - 6427185
Alignment:
| Q |
129 |
tctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||||||| |||||||||||| ||| | |||||||||| |||| |||||||| | | ||||| |||||||||||||||| |
|
|
| T |
6427102 |
tctggctttaaatggggccccacaagtggacagtgggattgaatccctcggattagtcggtccttgg-ccggataccgagttttc |
6427185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 211
Target Start/End: Complemental strand, 9646273 - 9646217
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
||||| |||||||||||||||| |||||||| | | ||||||||| |||||||||| |
|
|
| T |
9646273 |
tgggcagtgggattgatcccctcggattagtcggtcattggatcgggtaccgagttt |
9646217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 135 - 211
Target Start/End: Complemental strand, 20527111 - 20527035
Alignment:
| Q |
135 |
tttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
||||||| ||||||| || |||||||| |||||| || ||| |||||||| |||| ||||||| ||||||||||| |
|
|
| T |
20527111 |
tttaaacagggccccgtaagtgggcggtaggattggtctcctcggattagtcgatttttggatcaaataccgagttt |
20527035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 212
Target Start/End: Complemental strand, 24672337 - 24672305
Alignment:
| Q |
180 |
attagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
24672337 |
attagtcgattcttggatcggataccgagtttt |
24672305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 211
Target Start/End: Complemental strand, 25969587 - 25969504
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttt |
211 |
Q |
| |
|
|||||| ||||||||||| |||| || || |||||||||||| | |||| | |||||| |||||||| ||||||||| |||||| |
|
|
| T |
25969587 |
gctctggctttaaacgggcccccgtaagtgagcggtgggattggt-ccctcgaattagtcgattcttgaatcggatactgagttt |
25969504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0217 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 128 - 212
Target Start/End: Complemental strand, 7394 - 7309
Alignment:
| Q |
128 |
ctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7394 |
ctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccaagtttt |
7309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 129 - 213
Target Start/End: Original strand, 39205 - 39290
Alignment:
| Q |
129 |
tctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39205 |
tctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagttttc |
39290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 133 - 212
Target Start/End: Complemental strand, 13127 - 13047
Alignment:
| Q |
133 |
actttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||||| ||| ||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
13127 |
actttaaacggggcccccgcaagtggacggtgggattgatcccctcagattagttgattcttggatcggataccgagtttt |
13047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 127 - 213
Target Start/End: Original strand, 40436 - 40522
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40436 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtccc-tcggattagtcgattcttggatcggataccgagttttc |
40522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 127 - 212
Target Start/End: Original strand, 66865 - 66951
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
66865 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtcggtccttggatcggataccgagtttt |
66951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 161940 - 162007
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| ||||||||||||||| |||||| |||||||| |||||||||||| |||||||||||||| |
|
|
| T |
161940 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagttttc |
162007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0459 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0459
Description:
Target: scaffold0459; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 10779 - 10694
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||| ||||||||||| |||||| | |||||| |||||| ||||||||||||||||||| |
|
|
| T |
10779 |
gctctggctttaaatggggccccacaagtggacggtgggattggtcccctcgaattagtcaattctt-gatcggataccgagttttc |
10694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 52957 - 52870
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| || |||||||| |||||| ||| || |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
52957 |
gctctggctttaaacggggcccccgcaggtgggcggtaggattggtcctctcggattagtcgattcttgaatcggataccgagttttc |
52870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1175 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold1175
Description:
Target: scaffold1175; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 2512 - 2426
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||||||||||||| |||||| |||||||| | |||| ||||||||||||||||| |
|
|
| T |
2512 |
gctctggctttaaacggggcccccgcaagtgggcggtgggattggtcccctcggattagtccgtccttgaatcggataccgagtttt |
2426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 155 - 212
Target Start/End: Complemental strand, 8508 - 8451
Alignment:
| Q |
155 |
tgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||||||| ||| || |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
8508 |
tgggcggtgggattggtccgctcggattagtcgattcttagatcggataccgagtttt |
8451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 9385 - 9299
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||| ||||||||||| |||||| | |||||| ||||||| ||||||||||||||||||| |
|
|
| T |
9385 |
gctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaattagtcgattctt-gatcggataccgagttttc |
9299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 12086 - 12000
Alignment:
| Q |
127 |
gctctgactttaaacggggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatc-ggataccgagttttc |
213 |
Q |
| |
|
|||||| ||||||| |||||||||||| ||| ||||||||||| |||||| | |||||| |||||| |||| ||||||||||||||| |
|
|
| T |
12086 |
gctctggctttaaatggggccccacaagtggacggtgggattggtcccctcgaattagtcaattctt-gatcgggataccgagttttc |
12000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0068 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0068
Description:
Target: scaffold0068; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 41730 - 41644
Alignment:
| Q |
127 |
gctctgactttaaacggggcccc-acaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||||| |||||||||||||||| ||| ||||| |||||||| |||||| |||||||| ||||||| |||||||||| |||||||| |
|
|
| T |
41730 |
gctctggctttaaacggggcccctgcaagtgggcaatgggattggtcccctcggattagtcgattctt-gatcggatacagagttttc |
41644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 146 - 213
Target Start/End: Original strand, 32419 - 32485
Alignment:
| Q |
146 |
ccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagttttc |
213 |
Q |
| |
|
|||| ||| |||| |||||||||| |||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
32419 |
ccccgcaagtgggtggtgggattggtcccctcggattagtcgattcttg-atcggataccgagttttc |
32485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0623 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0623
Description:
Target: scaffold0623; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 1142 - 1057
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||| ||||||| |||||||| ||| ||| ||||||||||| |||||| | |||||| ||||||| |||||||||||||||||| |
|
|
| T |
1142 |
gctctggctttaaatggggcccccgcaagtggacggtgggattggtcccctcgaattagtcgattctt-gatcggataccgagtttt |
1057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 212
Target Start/End: Complemental strand, 97452 - 97366
Alignment:
| Q |
127 |
gctctgactttaaacggggcccca-caaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||| ||||||||||||||| ||| || | |||||| | || ||||| ||||||||||||||| |
|
|
| T |
97452 |
gctctgactttaaacgggacccccgcaagtgggcggtgggattggtcctctcgtattagtcggtttttggaccggataccgagtttt |
97366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 143 - 212
Target Start/End: Complemental strand, 123134 - 123066
Alignment:
| Q |
143 |
gggccccacaaatgggcggtgggattgatccccttggattagtagattcttggatcggataccgagtttt |
212 |
Q |
| |
|
||||||||||| || | |||||||||| |||||| |||||| | || |||||||||||||||| |||||| |
|
|
| T |
123134 |
gggccccacaagtgtgtggtgggattggtcccctcggattaatcga-tcttggatcggataccaagtttt |
123066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University