View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_high_20 (Length: 253)
Name: NF12832_high_20
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_high_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 42463256 - 42463379
Alignment:
| Q |
1 |
ttctggtggtgcaggaagaggaaggtgcatccggaagcatgtgatcgttactcctaaggctgtttctgattcacagaattctcagacttgccttgatcct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463256 |
ttctggtggtgcaggaagaggaaggtgcatccggaagcatgtgatcgtcactcctaaggctgtttctgattcacagaattctcagacttgccttgatcct |
42463355 |
T |
|
| Q |
101 |
gacgctagcagagtgagtttatat |
124 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42463356 |
gacgctagcagagtgagtttatat |
42463379 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 157 - 240
Target Start/End: Original strand, 42463412 - 42463495
Alignment:
| Q |
157 |
agagctaagagctgaatgaaaagtagttaaaattgttaattttctatcacatatgagtgtatgtcaaatcatatgttagtgttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42463412 |
agagctaagagctgaatgaaaagtagttaaaattgttaattttctatcacatatgagtgtatgtcaaatcatatgttagtgttc |
42463495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 37076814 - 37076882
Alignment:
| Q |
51 |
ctcctaaggctgtttctgattcacagaattctcagacttgccttgatcctgacgctagcagagtgagtt |
119 |
Q |
| |
|
|||||||||||||||||||||| | || ||||||||||| |||||||| || ||||||||||| |||| |
|
|
| T |
37076814 |
ctcctaaggctgtttctgattccaaaaactctcagacttgtcttgatccagatgctagcagagttagtt |
37076882 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University