View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_high_23 (Length: 240)
Name: NF12832_high_23
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 235
Target Start/End: Original strand, 46774831 - 46775048
Alignment:
| Q |
18 |
aaatggtactcatgagtgtttcgggaagtttgttgctcgtcaaattcaattggattgcatcttcttggtaatgccctcatctcatctttatacattttcc |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| | |
|
|
| T |
46774831 |
aaatgttactcatgagtgtttcgggaagtttgttgctcgtcaaattcaattggattgcatcttcttggtaatgccctcctctcatctttatacctttgct |
46774930 |
T |
 |
| Q |
118 |
cttttcttattagtctaaatttaatattgtctatttctaggctttcttgaaaattatttataggccaagtatttatgcagcaaaaatttatgcttaagta |
217 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46774931 |
cttttcttattagtctaaatttaatactgtctatttctaagctttcttgaaaattatttataagccaagtatttatgcagcaaaaatttatgcttaagta |
46775030 |
T |
 |
| Q |
218 |
atgccaaaaataaggagt |
235 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
46775031 |
atgccaaaaataaggagt |
46775048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University