View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_high_25 (Length: 232)
Name: NF12832_high_25
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_high_25 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 12399882 - 12399667
Alignment:
| Q |
1 |
gaaggaccttatcaaaaagaaaagatacttgtagcagtcaagcaatactggacagctccaccaacagagcaaaactaacacaacaagtattagtttgt-t |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12399882 |
gaaggaccttatcaaaaagaaaagatacttgtagcagtcaagcaatactggacagctccaccaacagagcaaaactaacacaacaagtattagtttgttt |
12399783 |
T |
|
| Q |
100 |
tttgtttatgacaaaactttcacaggaattcaattctttcaaacagcaattttttgttttggtgcttataagagaaattttgttcattaagttatggcac |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12399782 |
tttgtttatgacaaaactttcacaggaattcaattctttcaaacagcaattttttg-tttggtgcttataagagaaattttgttcattaagttatggcac |
12399684 |
T |
|
| Q |
200 |
cttaacatcttgaagct |
216 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
12399683 |
ctcaacatcttgaagct |
12399667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 61
Target Start/End: Complemental strand, 28637501 - 28637453
Alignment:
| Q |
13 |
caaaaagaaaagatacttgtagcagtcaagcaatactggacagctccac |
61 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| || |||||||| |||| |
|
|
| T |
28637501 |
caaagagaaaagatacttgtagcagtcaagcagtattggacagccccac |
28637453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University