View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_low_18 (Length: 317)
Name: NF12832_low_18
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 16 - 158
Target Start/End: Complemental strand, 8823319 - 8823177
Alignment:
| Q |
16 |
acatcaatagtgacaacctttgctcctgagctacacaagacaaaaacaagaagaagaagaaacgccaaacaacgaggtaacaagtttgctgaaacagcag |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823319 |
acatcaatggtgacaacctttgctcctgagctacacaagacaaaaacaagaagaagaaaaaacgccaaacaacgaggtaacaagtttgctgaaacagcag |
8823220 |
T |
|
| Q |
116 |
ccattgttgtatatggtttgtaacttgcaagctagttaatctt |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823219 |
ccattgttgtatatggtttgtaacttgcaagctagttaatctt |
8823177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 191 - 303
Target Start/End: Complemental strand, 8823144 - 8823032
Alignment:
| Q |
191 |
gtgatttttactaaagcatttaagttcagttgaagtatatgaaaaacacaataaatgtaagtttatttatatgtaagcagcatgttggtttggtttgaaa |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823144 |
gtgatttttactaaagcatttaagttcagttgaagtatatgaaaaacacaataaatgtaagtttatttatatgtaagcagcatgttggtttggtttgaaa |
8823045 |
T |
|
| Q |
291 |
tctggtgtctctg |
303 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8823044 |
tctggtgtctctg |
8823032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University