View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_low_25 (Length: 273)
Name: NF12832_low_25
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 154 - 264
Target Start/End: Original strand, 8714685 - 8714795
Alignment:
| Q |
154 |
gggaacataaaacatgtgacgcacccctgcagctttccactctctcccgtctccactattgtttgccaaacaatgcatctgaatttgagctttctttctt |
253 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8714685 |
gggaacataaaacatgtggggcacccctgcagctttccactctctcccgtctccactattgtttgccaaacaatgtatctgaatttgagctttctttctt |
8714784 |
T |
 |
| Q |
254 |
tttatgaatct |
264 |
Q |
| |
|
||||||||||| |
|
|
| T |
8714785 |
tttatgaatct |
8714795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 156
Target Start/End: Original strand, 8714517 - 8714655
Alignment:
| Q |
18 |
ctctttaggcttcctaatatctctaagatctcttaaatacacatttgattgttatctatcagacatacannnnnnnaaaaacgtagatctgataaataac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |||| ||||||||||||| |||||||||| |
|
|
| T |
8714517 |
ctctttaggcttcctaatatctctaagacctcttaaatacacatttgattgttatctatcaaacgtacattttaaaaaaaacgtagatccgataaataac |
8714616 |
T |
 |
| Q |
118 |
caccaaatatgtatttagaaggcgttaaagatatcaggg |
156 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||| |||| |
|
|
| T |
8714617 |
catcaaatatgtatttagaaggcgttagagatattaggg |
8714655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University