View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_low_35 (Length: 229)
Name: NF12832_low_35
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_low_35 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 211
Target Start/End: Complemental strand, 28702863 - 28702668
Alignment:
| Q |
13 |
gagatgaaggagcaaaaatacataattttacgtaaatataattgaagcaattaatgttctttcattctttgcacaacccattacaaagttatctctatca |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28702863 |
gagatgaaggagcaaaaatacataatttgacgtaaatataattgaagcaat----gttctttcattctttgcacaacccattacaaagttatctctatca |
28702768 |
T |
 |
| Q |
113 |
tcctcaacaatgttctttcaattcaagtactcaagatgaaggacccgaa-ctatccaattcggatttagtggtggctatggtgatagtggatgtagaagt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28702767 |
tcctcaacaatgttctttcaattcaagtactcaagatgaaggacccgaagctatccaattcggatctagtggtggctatggtgatagtggatgtagaagt |
28702668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University