View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12832_low_37 (Length: 209)
Name: NF12832_low_37
Description: NF12832
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12832_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 10 - 194
Target Start/End: Original strand, 35794294 - 35794478
Alignment:
| Q |
10 |
agaagcagagattttccgacaaagaaccacaacaacggcactccgctgccaaacccaatgcagccattagcttcgtagtggaaagttcacgcttctgtct |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35794294 |
agaagcacagattttccgacaaagaaccacaacaacggcactccgctgccaaatccaatgcagccattaacttcgtagtggaaagttcacgcttctgtct |
35794393 |
T |
 |
| Q |
110 |
cacagtgatcaaagtagacaggctgcagtacccataattggtctttcaattttttaagtttttcaatattcaatgtaatagtgat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35794394 |
cacagtgatcaaagtagacaggctgcagtacccataattggtctttcaattttttaagtttttcaatattcaatgtaatagtgat |
35794478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University