View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_high_14 (Length: 240)
Name: NF12833_high_14
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_high_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 32553115 - 32553337
Alignment:
| Q |
1 |
tattatggttcatttaagtgtcttttaattccacattaaaccagtttccatacattgaacaaacacaactagcattggcatgaggttccttctttgnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32553115 |
tattatggttcatttaagtgtcttttaattccacattaaaccagtttccatacattgaacaaacacaactagcattggcatgaggttccttctttgtttt |
32553214 |
T |
|
| Q |
101 |
nnnctccaaaccttgactccaacatgtcacaacattgtcacatgaaggcatagatgcacttcttttttcttcaatcaacatcctaaaaatgctccaacat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32553215 |
tttctccaaaccttgactccaacatgtcacaacattgtcacatgaaggcatagatgcacttcttttttcttcaatcaacatcctaaaaatgctccaacat |
32553314 |
T |
|
| Q |
201 |
gtcacaaatttgtatgttgaatg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
32553315 |
gtcacaaatttgtatgttgaatg |
32553337 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University