View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_high_19 (Length: 228)
Name: NF12833_high_19
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 10506400 - 10506463
Alignment:
| Q |
146 |
taaacaacattacacaaaagagaagtgttagatatactctctttctaacactcttcaacacatat |
210 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10506400 |
taaacaacattacacaaaa-agaagtgttacatatactctctttctaacactcttcaacacatat |
10506463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University