View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_high_20 (Length: 224)
Name: NF12833_high_20
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 10 - 209
Target Start/End: Original strand, 37215903 - 37216100
Alignment:
| Q |
10 |
taaccaaataaaaatgcaagaatatacaaacctcttgaacagttttagaccatttggagttccacatctgaaactgaggcagatctctgatttcatggtt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
37215903 |
taaccaaataaaaatgcaagaatatacaaacctcttgagcagttttagaccatttggagttccacatctgaaaccaaggcagatct--gatttcatggtt |
37216000 |
T |
|
| Q |
110 |
gcagtcatagtaggagtttcacccctgaaatcgataaatgcaactcatgtaaatataacataattaaaattgnnnnnnngtgtgcatataatcccctatg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37216001 |
gcagtcatagtaggagtttcacccctgaaatcgataaatgcaactcatgtaaatataacataattaaaattgtttttttgtgtgcatataatcccctatg |
37216100 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University