View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_high_8 (Length: 293)
Name: NF12833_high_8
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 16 - 289
Target Start/End: Complemental strand, 7166944 - 7166666
Alignment:
| Q |
16 |
caaagaacatatcaaagatgaaaattccatgaagagagaagaaatcagggaaaagtgttcctgagccatgcgtgcgtcttgaaggatgaaggcacacacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
7166944 |
caaagaacatatcaaagatgaaaattccatgaagagagaagaaatcggggaaaagtgttcctgagccatgtgtgcgtcttgaaggacgaaggcacacacc |
7166845 |
T |
 |
| Q |
116 |
cgaatcaaagttgccgcatgttttacagtctaaaacacaacactcatgcgtgttgcgtaaacatgcatgcataataatgcgatttttcatccaaaaacaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
7166844 |
cgaatcaaagttgccgcatgttttacagtctaaaacacaacacttatgcgcgttgcgtaaacatgcatgcataataatgtgttttttcatccaaaaacaa |
7166745 |
T |
 |
| Q |
216 |
gggtttggaatcttgacggc--tcaggtcgcactttttagcaatggaa---acatgactgaagacaattcttctcactc |
289 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
7166744 |
gggtttggaatcttgacggcgatcaggtggcactttttagcaatggaaattacatgactgaagacaattcttatcactc |
7166666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University