View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_low_11 (Length: 300)
Name: NF12833_low_11
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 20 - 283
Target Start/End: Complemental strand, 13923383 - 13923120
Alignment:
| Q |
20 |
gcttgatacattcactgaagtgtgactggtatttatctggttcatcttccatcaacacctacaatgaataccgtaaagtataaaggttgtaaccaaaatt |
119 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13923383 |
gcttgatatattcactgaagtgcgactggtatttatctggttcatcttccatcaacacctacaatgaataccataaagtataaaggttgtaaccaaaatt |
13923284 |
T |
|
| Q |
120 |
tctagatacctttataatgaatgcacaaaaaataaggagaacaaagtacaattttcccacttgccttcatatagtaagcaacatgtccaccgaagatatt |
219 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13923283 |
tctagatacctttataaagaatgcactaaaaataaggagaacaaagtacaattttcccacttgccttcatatagtaagcaacatgtccaccgaagatatt |
13923184 |
T |
|
| Q |
220 |
tttacggcgagcctcaacatcaagctttttcttctcctcgtcgaaaccaacaaaccttttatca |
283 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
13923183 |
tttacggcgagcctcagcatcaagctttttcttctccttgtcgaaaccaacaaaccttttatca |
13923120 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 183 - 279
Target Start/End: Original strand, 55232790 - 55232886
Alignment:
| Q |
183 |
ccttcatatagtaagcaacatgtccaccgaagatatttttacggcgagcctcaacatcaagctttttcttctcctcgtcgaaaccaacaaacctttt |
279 |
Q |
| |
|
||||||| ||| |||||||||||| || ||||| | || ||| || ||||| ||||||||| ||| ||||||| ||| |||||| |||||||||| |
|
|
| T |
55232790 |
ccttcatgtaggcagcaacatgtcccccaaagatgtacttccggtgaacctcagcatcaagctcttttttctccttgtcaaaaccagcaaacctttt |
55232886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University