View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_low_14 (Length: 274)
Name: NF12833_low_14
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 118 - 264
Target Start/End: Original strand, 37218922 - 37219068
Alignment:
| Q |
118 |
acttttaatgcatggatgtctgcgattccaaatcaacgacagacaaatattttaagtaaaagtttttgcaagaatatacaaacctcttcaacaattttat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37218922 |
acttttaatgcatggatgtctgcgattccaaatcaacgacagacaaatattttaagtaaaagtttttgcaagaatatacaaacctcttcaacaattttat |
37219021 |
T |
 |
| Q |
218 |
agcacttggagttgcacccttgaaattgtggctgatatgattctgtg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37219022 |
agcacttggagttgcacccttgaaattgtggctgatatgattctgtg |
37219068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University