View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12833_low_15 (Length: 255)
Name: NF12833_low_15
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12833_low_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 39584225 - 39584434
Alignment:
| Q |
10 |
agaagcaaagggaagtgctttatttcctttgagggcaaagagagtactttacagtttacataagccaaaagaaaaagatactgtaatctgtaatggttta |
109 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39584225 |
agaaacaaagggaagtgctttattttctttgagggcaaagagagtactttacagtttacataagccaaaagaaaaagatactgtaatctgtaatggttta |
39584324 |
T |
 |
| Q |
110 |
ttaatggcaatcaacataaagagcaattcaaaatgacattagcattatgatggaatagcatgtcgcaggctatatttttgttagcttaatgagtggtggg |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39584325 |
ttaatggcaatcaacataaagagcaattcaaaatgatattagcattatgatggaatagcatgtcgcaggctatatttttgttagcttaatgagtggtggg |
39584424 |
T |
 |
| Q |
210 |
aaaattttgc |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
39584425 |
aaaattttgc |
39584434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University