View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12833_low_23 (Length: 228)

Name: NF12833_low_23
Description: NF12833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12833_low_23
NF12833_low_23
[»] chr1 (1 HSPs)
chr1 (146-210)||(10506400-10506463)


Alignment Details
Target: chr1 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 10506400 - 10506463
Alignment:
146 taaacaacattacacaaaagagaagtgttagatatactctctttctaacactcttcaacacatat 210  Q
    ||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||    
10506400 taaacaacattacacaaaa-agaagtgttacatatactctctttctaacactcttcaacacatat 10506463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University