View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12834_high_8 (Length: 228)
Name: NF12834_high_8
Description: NF12834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12834_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 23 - 209
Target Start/End: Complemental strand, 18348749 - 18348562
Alignment:
| Q |
23 |
agggggccctttgtgagactgttactgaggagaaaggggaaatgcaccagctagacatgaccacacaattagggcacatcatcaaagaccatgtcgtatg |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
18348749 |
agggggccctttgtgagactgttactgaggagaaaggggaaatgcaccagctagacatgaccacacaattagggcacatcatcagagaccatgtcgtatg |
18348650 |
T |
 |
| Q |
123 |
gataatgttcggtggtcaagtggagtagggaagtccaacatgaccgagtttgaagc--agatattgggtaaggtttagggagggttgat |
209 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||||||||||||||||||||||| |||| |||| | ||||||||||||||||||| |
|
|
| T |
18348649 |
gataatgttcggtggtcaagtggagtactg-agtccaacatgaccgagtttgaagcatagatcttggatgaggtttagggagggttgat |
18348562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 102 - 147
Target Start/End: Original strand, 17933860 - 17933905
Alignment:
| Q |
102 |
catcaaagaccatgtcgtatggataatgttcggtggtcaagtggag |
147 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||| ||||||| |
|
|
| T |
17933860 |
catcaaagaccatgtcgtagggataatgatcgatggtctagtggag |
17933905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University