View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12834_low_6 (Length: 298)
Name: NF12834_low_6
Description: NF12834
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12834_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 2e-40; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 173 - 273
Target Start/End: Original strand, 8664275 - 8664375
Alignment:
| Q |
173 |
ttaagttattgttgctgcttgggcacttggttgaaccggtacctcaacagcacttgtctttgcctctctctgagcaaggtatgtagggtgctctatacct |
272 |
Q |
| |
|
||||||||||||| ||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8664275 |
ttaagttattgttactgcttgtgcacttggttcaaccggtacctcaacaacacttgtctttgcctctctctgagcaaggtatgtagggtgctctatacct |
8664374 |
T |
|
| Q |
273 |
t |
273 |
Q |
| |
|
| |
|
|
| T |
8664375 |
t |
8664375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 202 - 291
Target Start/End: Original strand, 8664403 - 8664492
Alignment:
| Q |
202 |
gttgaaccggtacctcaacagcacttgtctttgcctctctctgagcaaggtatgtagggtgctctataccttatttattttatgcttctc |
291 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| ||||||||| || | || ||| ||||||| ||||||||||||||||| |
|
|
| T |
8664403 |
gttgagccggtacctcaacagcacttgtctttgcctctctctaagcaaggtacgttgagtactcaataccttctttattttatgcttctc |
8664492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 215 - 254
Target Start/End: Complemental strand, 8664408 - 8664369
Alignment:
| Q |
215 |
ctcaacagcacttgtctttgcctctctctgagcaaggtat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8664408 |
ctcaacagcacttgtctttgcctctctctgagcaaggtat |
8664369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University