View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12835_high_11 (Length: 329)
Name: NF12835_high_11
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12835_high_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 234 - 315
Target Start/End: Complemental strand, 280807 - 280726
Alignment:
| Q |
234 |
tgatatcttatgatattgattttaatatatagtttaataatctgtgtaacgcgtattgattgattattgaattctttctgtg |
315 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
280807 |
tgatatcttatgatattgattatagtatatagtttaataatctgtgtaacgcgtattggttgattattgaattctttctgtg |
280726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 86 - 128
Target Start/End: Complemental strand, 280955 - 280913
Alignment:
| Q |
86 |
ggctatgtcagaagaaatgtggaagaagagatagataaggttg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
280955 |
ggctatgtcagaagaaatgtggaagaagagatagctaaggttg |
280913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University