View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12835_high_11 (Length: 329)

Name: NF12835_high_11
Description: NF12835
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12835_high_11
NF12835_high_11
[»] chr6 (2 HSPs)
chr6 (234-315)||(280726-280807)
chr6 (86-128)||(280913-280955)


Alignment Details
Target: chr6 (Bit Score: 70; Significance: 2e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 234 - 315
Target Start/End: Complemental strand, 280807 - 280726
Alignment:
234 tgatatcttatgatattgattttaatatatagtttaataatctgtgtaacgcgtattgattgattattgaattctttctgtg 315  Q
    ||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
280807 tgatatcttatgatattgattatagtatatagtttaataatctgtgtaacgcgtattggttgattattgaattctttctgtg 280726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 86 - 128
Target Start/End: Complemental strand, 280955 - 280913
Alignment:
86 ggctatgtcagaagaaatgtggaagaagagatagataaggttg 128  Q
    |||||||||||||||||||||||||||||||||| ||||||||    
280955 ggctatgtcagaagaaatgtggaagaagagatagctaaggttg 280913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University